Unanswered gene has three exons that are 140, 230, and 130 bp, respectively. Intron 1 is 125 bp and intron s 95 bp. How long is the properly spliced mature RNA transcript? 220 500 720 1500

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons.  Eukaryotic genomes are much…

Q: sgRNA GFP Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in the nucleus to…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: ALTE

A: Exon is a genetic code region that contains the information needed to enter a protein code. In…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: Below is the RNA sequence of a primary transcript. Underline (or highlight) each intron, and then…

A: The primary transcript of RNA sequence contains both introns and exons. Introns are generally spiced…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: Eukaryotic mRNAs have a 7-methylguanosine cap on their5' end. true/ false

A:

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The synthesis of multiple different protein isoforms from just one gene in eukaryotic cells would…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU nonsense Refer to…

A: Genetic codes are genetic information present in the nucleotide sequences of mRNA (messenger RNA)…

Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…

A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: All of the following are needed for capping of eukaryotic mRNA, EXCEPT   Question 27 options:…

A: Eukaryotic mRNA is a single-stranded ribonucleic acid. This is associated with the protein…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit…

A: The features of RNA that permit self-splicing (that is, in the absence of proteins)is that RNA is…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…

A: Exons are coding sequences and introns are the non-coding sequences. Splicing is the process of…

Q: What is the length in bp of the 5’ UTR, the mature processed mRNA and protein-coding region of the…

A: Transcription is the process by which a messenger RNA (mRNA) is produced from DNA.Translation is the…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…

A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: Exons are the coding sequences that is they code for a specific functional product either in the…

Q: Use the DNA sequence above, list all possible splicing products

A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In case of eukaryotic organisms after transcription premature mRNA is produced from the DNA (gene).…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…

A: CODONS 3 4 5 6 7 8 9   NORMAL PRO THR VAL THR THR ARG TRP   CODON CCC ACG GUG ACG ACA CGG UGG…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: As per the central dogma of molecular biology information stored within the DNA is transcribed onto…

Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…

A: Transcription is the process by which messenger rna is made from DNA.  This process takes place…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In eukaryotes, RNA transcription differs in comparison to the prokaryotes in terms of RNA splicing.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.