Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the mRNA sequence being generated here is hidden by the box. N 3 S TIL A A U DNA 910 Ox ΟΥ OZ O No answer text provided. 6 mRNA T X G A A G ENA Polymerase C D PPP A G 913
Q: 1 Draw a Ramachandran Plot indicating regions where a helices (left and right) and ß sheets are…
A:
Q: Differentiate the following based only on their general external anatomy: Beetles versus True Bugs
A: Insects are invertebrates that do not have a backbone or skeleton inside. They have a hard outer…
Q: Which of the following systems is predominantly stimulated by nicotine action in parasympathetic…
A: Introduction: The smooth and cardiac muscles are innervated by the nerves that make up the ANS. The…
Q: The largest cycloneuralians are also the only ones with external fertilization. Which phylum is…
A: * Cycloneuralians belongs to the clade of ecdysozoan animals which consists of Scalidophora and…
Q: 14. Name the three main components of the diencephalon, describing their functions.
A: We know that the brain develops from ectoderm and consists of three major parts : Forebrain: It…
Q: Grayson is receiving a drug treatment transdermally (through the skin). Explain why drugs delivered…
A: A drug's route of administration is the location or path by which it enters the body. To have the…
Q: Aquatic Biomes Which aquatic biome has exceptionally high biodiversity? Coral Reefs O Estuaries…
A: Coral reefs are made up of thousands of coral animals called as polyps that aggregate together to…
Q: Choose only one which is the correct? Which of the following best describes a trait of life? Trees…
A: 1) Trees that are able to produce fruits : The trees produces fruits due to influence from…
Q: Compare and contrast the operation of optical microscopy and TEM in terms of Contrast
A: Optical microscopy is a method used to carefully examine a specimen by magnifying it using visible…
Q: Consider the graph below. This is an example of whatkind of natural selection? O Directional…
A: Evolution is a steady phenomenon which cause transformation in life from much simple to more…
Q: Differentiate between the roles of the atrioventricular and semilunar valves.
A: The heart has valves to maintain the unidirectional flow of blood, called the heart valves. This…
Q: Choose only one which is the correct? Which of the following best describes a trait of life? A fever…
A: Introduction A variety of fundamental characteristics, including order, environmental sensitivity,…
Q: features that suggest the Cnidaria and Ctenophora share. Outline the features that distinguish these…
A: Cnidaria and Ctenophora are two phyla belonging to the kingdom Animalia. Cnidarians are named so…
Q: 7. Describe the primary function of neurotransmitters at the synapse.
A: Neurons are the nervous system's cells. They transport neural signals throughout the body as…
Q: In the evolution of vascular plants, there is a trend toward the: A above-ground parts becoming…
A: Introduction Aquatic flora characterised the earliest plants. In order to survive in dry…
Q: Identify which statement below is the fact, the law, and the theory. In the Serengeti, the savanna…
A: Introduction :- Using the scientific method, a theory is a well considered explanation for…
Q: Name three features often associated with the evolution of an endoparasitic lifestyle. Compare and…
A: -Explanation: Reduced or absent locomotive structures: -Endoparasites from the phylum Nematoda have…
Q: 12. d) noltionos le ter Wonsmo color-blind A red-green man (sex-linked gene) marries a normal woman.…
A: Introduction: Simply said, colour blindness is the inability to see or distinguish between colours…
Q: Using diagrams, illustrate how nondisjunction can result in an aneuploid zygote.
A: Introduction Aneuploidy is the condition when a cell has more chromosomes than normal, such as when…
Q: What was the order of divergence from oldest (1) to most recent (5)?
A: The accumulation of variations between genetically similar groups within a species that results in…
Q: the Highest P... 2019 Summer Inter... Match each of the parts of a eukaryotic (specifically, human)…
A: As per the hierarchy of life, cell is the smallest entity that consists life of its own. It is…
Q: C= 56 wt.% H= 6 wt.% O= 34 wt.% N = 4.2 wt.%
A: When the carbonization process occurs, biomass becomes a more carbon that is a natural gas. Hence…
Q: Selfing changes genotype frequencies within populations. A) True B) False
A: Introduction :- A population's genotype frequency is calculated by dividing the number of people…
Q: All can be said of dendrites, EXCEPT: they must grow in size to be able to "learn" undergo…
A: Dendrites are finger-shaped cells located at the end of each neuron. The dendrites are small but…
Q: 1) If an animal cell is placed in HYPERTONIC solution, what happens to the cell? nothing happens…
A: Based on osmotic concentration solutions can be of three types namely- hypertonic solution,…
Q: A diploid species has 3 pairs of chromosomes in the somatic cells. In males, the first pair is large…
A: Introduction : The thread-like structures present in the nucleus of the cell are known as…
Q: Which of the following processes and or mechanisms of evolution violate the assumptions of…
A: The Hardy-Weinberg principle states that a population’s allele and genotype frequencies will remain…
Q: Classify and characterize the plant-like protists (algae) based on the following parameters.…
A: Introduction Plant-like protists are called algae. They consist of seaweed with many cells and…
Q: Why can solar induced fluorescence be used to infer net photosynthesis? Please explain in detail how…
A: Introduction Plants may produce their own energy from sunlight through a process known as…
Q: Which option best describes why it is important for scientist to evaluate the results of their…
A: Experiment The scientists do experiment in order to get proof of something or to get new knowledge…
Q: 86 Which of the following is NOT associated with the prokaryotic cell memb is selectively permeable…
A: The membrane which allow the passage of solvent molecules but do not allow the passage of solute…
Q: A cat has 38 total chromosomes (19 pairs). If one cell undergoes either mitosis or meiosis, identify…
A: Introduction When a mother cell divides into two or more daughter cells, this process is known as…
Q: Explain the processes for photosystems 1 and 2 in photosynthesis.
A: When compared to bacteria, the photosynthetic apparatuses of modern cyanobacteria, algae, and…
Q: e al g As part of global climate change, the Earth is warming. If a region that currently supports a…
A: Temperate forest is mainly defined by the canopy of broad-leaved trees distributed more or less…
Q: 20 Assume height in humans is determined by three genes. A, B, and C each of which also occurs as a…
A: Introduction: Multi-gene-influenced features are referred to as polygenic traits. Height and eye…
Q: Name the specific names of cells found in blood
A: Introduction Blood and lymph are two fluid connective tissues that flow throughout our…
Q: 17. Which statement is true with regards to bacteria? Bacteria can be used to produce products such…
A: Introduction : Bacteria are prokaryotic, unicellular(i.e single-celled) organisms and do not have a…
Q: Make a Punnet Square of the breed between a pink ( RW) flower with red (RR) flower.. Write all…
A: Introduction When one allele totally dominates another, the dominant phenotype is conferred by the…
Q: Use the data in the accompanying table that summarizes results from a clinical trial of a drug. Find…
A: The odd ratios give us an indication of the effectiveness of the drug treatment. The placebo is the…
Q: Other than salinity, what other parameters can a refractometer measure? How is it different from…
A: The amount of salt present in water or soil is referred to as salinity. Primary salinity (also known…
Q: EVS diagram - 5 inputs that have influenced your EVS - Explanation of where you are on the EVS…
A: An ecosystem comprises all of the organisms in a particular region that interacts with the physical…
Q: Joints Shoulder Anthrology of Joints Familiarize yourselves with the different joints of the body…
A:
Q: All land plants produce. ______by mitosis and ____________ by meiosis. Selected Answer: spores;…
A: Introduction: The haploid and diploid generations of plants alternate during their life cycle. Only…
Q: Describe the features of the fluid mosaic model of the cell membrane in detail
A: Please follow step 2 for detailed explanation.
Q: 12, Name the three main plexuses and the major nerves derived from each.
A: A nerve plexus is a plexus (branching network) of intersecting nerves. A nerve plexus is composed of…
Q: What problem would be caused by moving the beaker during the devlopment of the chromatogram?
A: Chromatography is the technique of laboratory in which separation of mixture takes place from it's…
Q: Identify which statement below is the fact, the law, and the theory. In the Serengeti, the savanna…
A: In the serengiti,sawana grasses are very aboundant,wildbests are common and lion are rare . this…
Q: what challenges can scientists encounter while cloning cells and using stem cells in tissue…
A: Introduction When an organism's tissue is damaged by outside influences and partially lost, tissue…
Q: How do the “types of vertebrae” change throughout the evolution of vertebrate taxa, from fish (2…
A: Comparative anatomy is the study of the anatomy of more than one species. Rather than focusing on a…
Q: Terrestrial Biomes Which is the largest terrestrial biome? Chapparal O Desert O Northern Coniferous…
A: * A biome is a large area which is characterized by its vegetation and climate and soil and…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleTranslate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'
- 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf