Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the mRNA sequence being generated here is hidden by the box. N 3 S TIL A A U DNA 910 Ox ΟΥ OZ O No answer text provided. 6 mRNA T X G A A G ENA Polymerase C D PPP A G 913

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: Obj 29. Identify the specific terms applied to the process of protein synthesis described by each…

A: Epinephrine, also known as adrenaline, is a hormone and neurotransmitter that plays a critical role…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: 41/ An RNA which has a functional group that allows & to act as a catalysts generaly called

A: This question is based on ribonucleic acid (RNA).

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

A:

Q: DNA Original T GC G C CTA A C G A G Replication DNA Copy Transcription MRNA Translation 1RNA Amino…

A: We are answering 2nd image as first image is not clear. pls repost it with deatils.

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: What is the name of the DNA strand which copies the MRNA?

A: The DNA is genetic material in living organisms that is made up of two antiparallel polynucleotide…

Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…

A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: The process of transcription is represented by letter

A: DNA is transcribed into mRNA and mRNA is translated into protein.

Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…

A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…

Q: The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from…

A: Introduction Amino acids are chemical molecules that combine to produce proteins; hence, they are…

Q: Codons are recognized by O DNA polymerase and a codon O FRNA and a codon O TRNA and an anticodon O…

A: Codon is a sequence made of DNA or RNA which corresponds to a particular amino acid.Genetic code is…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: A RNA  is produced by the process of transcription. Unit of transcription is called transcription.…

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: A DNA sequence is transcribed into an RNA molecule with the help of the enzyme RNA polymerase is…

Q: 2) Label the coding and the template strand in the table.

A: A                               G    A              C       T   T   A T C           T…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: If this was an Eukaryote, after this transcript under A (T) (C) C G G DE G g and exits the nucleus…

A: The correct answer is option D. 5; Cap

Q: What was the purpose of the random hexamer primers? O primer for GoTaq O amplify the MRNA O primer…

A: Primer These are the short nucleic acid sequences that are are helpful in providing an initiator…

Q: DNA sense strand DNA anti-sense strand mRNA tRNA   Which nucleic acids have the same nucleotide…

A: DNA sence  strand or coding strand A T G A T G T G C C G A T G A DNA antiSENSE strand or template…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: Match a descriptor to each region of the diagram for transcription and translation. case 00 ACCOCO…

A: The copying of a DNA segment into RNA is known as transcription.In this process the DNA segment is…

Q: у OH ON Replication. OH

A: Molecular biology is a branch of biology that focuses on the study of biological molecules and their…

Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…

A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base…

A: In DNA Adenine, Guanine, Cytosine, and  Thymine are present as nitrogen bases. Adenine(A) binds with…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.