You have found two mutant alleles of Gene A that have insertion of thethree base pairs (as shown in the box on the right) immediately after theC/G base pair at positions, 100 or 150. Complete the table below for each of the followingmutations.b.5' CGA 3'3' GCT 5'Positions of insertions of the above three base pairsAfter 100th base pairAfter 150th base pairi. Effect on the length of mRNA(longer than/ shorter than/same as the MRNA produced bythe wild- type allele of Gene A).Explain briefly.ii. Effect on the length ofprotein (longer than/ shorterthan/ same as the proteinproduced by the wild- typeallele of Gene A). Explainbriefly.iii. Does this mutation affect thereading frame? Why/why notiv. If the protein is produced,will it be functional? Explainbriefly.U bs Msni s CSASeo yd b A ebias orira GUUU Phe (F) UCU Ser (S) |UAU TyUCCUUCUUA Leu (L) UCAUUGUACUAA StopUAG StopUGU Cys (C)UGCUGA StopUGG Trp (W)UCGCUU Leu (L) CCU Pro (P) CAU His (H) CGU Arg (R)CGCCUCCCỦACCCССАCCGCÁCCAA Gln (Q) CGACAG%3DCUGCGGAUU Ile (I)AUCAUAAUG Met (M) ACGACU Thr (T) AAU Asn (N) AGU Ser (S)ACCACAAGCAACAAA Lys (K) AGA Arg (R)AAG%3DAGGGUU Val (V) GCU Ala (A) GAU Asp (D) GGU Gly (G)GGCGACGAA Glu (E) GGAGAG%3DGUCGGUAGCCGCAGCGGGGGUG 1. The following is the partial DNA sequence of Gene A.Note: The underlined sequence (from position 20-54) represents the promoter for GeneA and the underlined and italicized sequence (from position 71-90 represents theribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/Abase pair at position 60.10203040506070---5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC3 TAGCCAGAGCCGATGATGTATTTGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATGPromoter8090100110120130140---5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGCRBS150160170180190200210--I---I---5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTTWhat are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint:Find the DNA coding strand, Note: A Genetic codon chart is provided on the next page ofthis problem set.a.

Name: You have found two mutant alleles of Gene A that have insertion of th
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You have found two mutant alleles of Gene A that have insertion of thethree base pairs (as shown in the box on the right) immediately after theC/G base pair at positions, 100 or 150. Complete the table below for each of the followingmutations.b.5' C