11. Draw the tRNAs on top of the following mRNA template. Make sure to include the anticodon and correct amino acid on each tRNA 5-A UGCCGUACCAGGA G-3¹

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: 14. Which mutation would be more harmful to a cell? For each predict the outcome of each mutation…

A: In order to base-pair with the correct codon on the mRNA during protein synthesis, the anticodon is…

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: The functions of DNA and RNA are controlled by genes. Genes are made up of a distinct collection of…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…

A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: First letter U C G U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA…

A: The central dogma is a fundamental principle in molecular biology that involves the transfer of…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: The transcribed portion of a DNA sequence for a gene is shown below. Identify the MRNA sequence and…

A: The procedure of determining the order of the four nucleotide bases (adenine, thymine, cytosine, and…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: e transfer-RNA and the amino acid structure attached to 5' 10

A: In molecular biology and genetics,translation is a process which comes after transcription and in…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: 7. The large subunit of the ribosome contains the E, P, and A sites. Discuss what occurs at each…

A: Ribosomes are cell organelles involved in the synthesis of proteins, they are present freely in the…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: This one is "charged" with an aminoacid. The specific sequence in the bottom is called the…

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'As following the rules in genetic code the mRNA…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right…

A: The tRNA or the transfer acyl Ribonucleic Acid serves as an adapter molecule during the process of…

Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…

A: As per the guidelines we are supposed to answer only the first question in case of multiple question…

Q: Match the function with the appropriate protein or sequence:

A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3     AAU…

A: Ans - a.)  AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: tRNA possess a set of three nucleotides known as an anticodon. The anticodon of tRNA binds to one or…

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: Use the mRNA codon table below to answer the question. A tRNA with the anticodon 5' AUG 3' would…

A: tRNA contains a triplet anticodon which pairs with complementary triplet codon present in mRNA…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…

A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…

Q: All tRNA molecules have poly (A) tails at their 3' end. Yes or no

A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3

A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…

Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…

A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: Although aminoacyl-tRNA synhtetases make few errors, occasionally an error. How can these error be…

A: The translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.