Phenylalanine 3' Third base of Baso in anticodon can be: U, I, xm5s?U, xm Um, Um, xm*U, xo°U, k?c MRNA codon: AAG A, G, U, I, xoU :Wobble position С, Д U, хо*U 13' G, A, I (a) Location of wobble position (b) Revised wobble rules
Q: Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…
A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while…
Q: Discuss the significance of modified bases within tRNA molecules.
A: There are four nucleotide bases present in DNA such as Adenine (A), Thymine (T), Guanine (G) and…
Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…
A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…
Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…
A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…
Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…
A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…
Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…
A: Introduction In the protein translation process, the key role is played by the tRNA which…
Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…
Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: What molecular biology strategy can best be used to determine Failure of t-RNA to bind at the A site…
A: In prokaryotes, transcription and translation occur simultaneously as generation time is 20…
Q: Which of the following statements about RNA structure is FALSE? O A. A sequence in a tRNA that forms…
A: A transfer RNA is an adaptor molecule that is composed of RNA and serves as the physical link…
Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Arginine is coded by six mRNA codons.
Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…
A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…
Q: ollowing is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the…
A: mRNA is the polymer of nucleotides formed by the process of transcription using the DNA template…
Q: A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type…
A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…
Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…
A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…
Q: In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These…
A: Codon is located on mRNA while anticodon is on tRNA. Anticodons specifically identifies and pair to…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the…
A: tRNA or transfer RNA is the RNA molecule that attaches to an amino acid as per the anticodon…
Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…
A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: tRNA It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…
Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…
A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…
Q: Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce…
A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…
Q: Which of the following is not true? There are two major classes of aminoacyl-tRNA synthetases…
A: Central dogma includes three main processes Replication, Transcription, and Translation.…
Q: A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain…
A: A nonsense mutation is defined as the process of the substitution of only a single base pair. This…
Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…
A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…
Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…
Q: Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or…
A: The attachment of the amino acid to the cognate tRNA is caused by the aminoacyl-tRNA synthetase.…
Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…
A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…
Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…
A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…
Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…
A: Translation is a method or process by which the message on the messenger RNA is converted into a…
Q: The charging of a tRNA with an amino acid can be represented by the following equation:amino acid +…
A: Translation is a biochemical phenomena in which mRNA molecule gets translated to proteins. Charging…
Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…
A: Translation is a orocess in which mRNA produce protein by the help of ribosome and tRNA.there are…
Q: What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5' 3' direction…
A: Each ribosomal subunit has three binding sites for tRNA: the A (aminoacyl) site, which accepts the…
Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…
A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…
Q: The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b.…
A: initiation factors bind to the repressors to regulate the process of translation there are three…
Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…
A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…
Q: Renata enzymatically conjugates a l"C-labeled cysteine to a transfer RNA (TRNA), with a UGU…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: The first aminoacyl-TRNA that binds to the ribosome: a. is a special fMet-tRNAet in prokaryotes. b.…
A: mRNA transcribed from nucleic acid will be translated into peptide sequence by ribosome. Ribosome…
Q: The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair…
A: Normal complementary nucleic acid sequences bind to each other by Watson and Crick base pairing but…
Q: What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to…
A: The soluble ribonucleic acid (tRNA) plays a significant function in protein synthesis.
Q: A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes…
A: The translation is a process by which the proteins are synthesized. Proteins are important for the…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…
Q: Why are transfer RNAs important in translation? Dogenes for tRNAs have promoters, and are…
A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…
Q: Sickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point…
A: Point mutation is the mutation of a single base pair that is the cause of sickle cell anaemia.
Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…
A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…
Q: The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following…
A: Transcription is a process through DNA is converted into mRNA.
The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids?
A. Leucine
B. Methionine
C. Serine
![Phenylalanine
3'
Third base of
Baso in
anticodon can be:
U, I, xm5s?U,
xm Um, Um,
xm*U, xo°U, k?c
MRNA codon:
AAG
A, G, U, I, xoU
:Wobble
position
С, Д U, хо*U
13'
G, A, I
(a) Location of wobble position
(b) Revised wobble rules](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Feb32ec49-6ef3-4345-8228-3c114d4d9dad%2F59aef4c7-ac85-4a02-8c07-1121ddda1e56%2Fs4o5on.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this genea) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.The following RNA: 5' AUGAUAACACUCGUACCUUAAUGU3' in the 5'-3'frame will betranslated into a peptide (use the table): Second letter A U G UAU Tyr UUC (F) UcC Ser UAC (Y) UCA (S)UAA Stop UUU Phe UCU UGU Cys UGC (Č) UUA Leu UGA Stop A UUG (L) UCG UAG Stop UGG Trp G (W) CUU CCU CAU His CGU CUC CCC Pro CÁC (H) CGC Leu САА GIn Arg CGA (R) CUA (L) A (P) CUG CCG CAG (Q) CGG AUU ACU AAU Asn AGU Ser Ile ACC (1) ACA (T) AAA AAC (N) AGC (S) AUC A AUA Thr AGA Arg Lys A AUG Met ACG (М) AAG (K) AGG (R) G GUU GAU Asp GCU GGU GCC Ala GUC Val G GUA (V) GCA (A) GAA Glu GAC (D) GGC Gly GGA (G) GUG GCG GAG (E) GGG G TLRECYH OA MITLVP Stop C OB IKVRLS MITLVP OD. First letter Third letter
- Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'AUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letter5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
- AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine QA) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
![Biology: The Unity and Diversity of Life (MindTap…](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)
![Biology: The Unity and Diversity of Life (MindTap…](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)