In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'

In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'

Name: In regard to the wobble hypothesis and the fact that cells do not need
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequencesPlease explain in depthA. 3'-ACA-5' B. 3'-

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 5P: Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than...

See similar textbooks

Related questions

Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…

A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Look up a standard genetic code table, how many codons will be recognized by tRNA charged by…

A: Introduction A gene can be defined as sequence of bases that encodes a functional protein molecule.…

Q: Give typing answer with explanation and conclusion Which of the following statements regarding the…

A: Understanding the structure and function of tRNA is crucial for comprehending the intricate process…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: A sequence of nucleotides in a DNA strand—5′-ttAACggCttttttC-3′— was used as a template to…

A: A template strand is the strand of the DNA that is also called a non-coding strand. By complementary…

Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: The sequence below shows the non-coding strand from the whole of the transcribed region of a very…

A: DNA undergoes transcription process to synthesize mRNA, which undergoes translation to synthesize…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction The process by which a gene's information is used to produce either RNA molecules that…

Q: For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…

A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes…

A: The translation is a process by which the proteins are synthesized. Proteins are important for the…

Q: Before the technology existed to synthesize RNA molecules of defined sequence (like ACACACAC.....),…

A: To calculate the probability of finding a Proline codon (CCU, CCC, CCA, or CCG) in the random RNAs…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…

A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Wobble hypothesis for the first nucleotide of the anticodon

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
None
A tRNA anticodon is 5ʹ GCU 3ʹ. What codon can it bind to and what amino acid should it carry? There are more than 1 answers. 5' AGA 3' arg 5' AGU 3' ser 5' CGA 3' arg (was not the answer) 5' UCC 3' ser 5' AGC 3' ser
Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
Shown here is a tRNA for tryptophan. Which of the locations on the tRNA accommodates looser base-pairing rules? H part 2 H₂N-C N H CH₂ -C || CH codons C 3 1 2 35' Choose one: IIIIIIIbase-pairing UGG anticodon in tRNA 5' Choose one: O A. site 3 OB. site 1 OC. All of the sites maintain strict base-pairing rules. OD. site 2 3' Using the genetic code here, determine the amino acids that a polynucleotide of UC would code for. AGA UUA AGC AGG AGU UUG CUA GUA GCA CGA GCC CGC GGA GGC CCA UCA ACA CCC UCC ACC AUA CUC GUC GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA UUC CCG UCG ACG UAC GUG GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU Lys Met Phe Pro Ser Thr Trp Tyr Val KM FPS T W Y V amino Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu DN E QGHIL acids A R с O A. Ser, His O B. Leu, Ser OC. Phe, Leu O D. His, Thr codon in mRNA UAA UAG UGA stop
please answer part 5
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the tRNA-Leu? 5'-CUG-3' 3'-GAC-5' 3'-CUG-5' 5'-GAC-3'
Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letter
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid