Before the technology existed to synthesize RNA molecules of defined sequence (like ACACACAC.....), it was possible only to synthesize RNA molecules of undefined (random) sequence. For example, RNAs ictin CO
Q: Imagine that you are hiking in the mountains one afternoon with friends. As you turn a corner, you…
A: a. The specific division of the nervous system that is responsible for the body's response to this…
Q: Indicate whether the following statements are true or false. If a statement is false, explain why it…
A: The statements provided pertain to various aspects of cell biology and membrane structure. By…
Q: Question 21> In 1668, Francesco Redi performed a series of experiments on spontaneous generation.…
A: The obsolete and disproven theory of spontaneous generation, also known as abiogenesis, holds that…
Q: A researcher interested in the disappearance of fallen leaves in a deciduous forest carried out a…
A: The researcher can learn more about the rate of disappearance or decomposition of fallen leaves over…
Q: May you please provide a source explaining/proving my answer. It can be anything on antibiotics,…
A: Research article:Samuel B, Volkmann T, Cornelius S, Mukhopadhay S, MejoJose, Mitra K, Kumar AM,…
Q: Which type of immune cell listed below recognises IgE bound to multicellular parasites and can…
A: Eosinophils are a type of white blood cell that is involved in the immune response against…
Q: 1 2 3 $/tonne 4 %CP 5 %Lysine 6 %Meth 7 %TSSA 8 %Thre A 9 %Tryp 10 DE 11 %Ca 12 %P 13 14 15 %CP 16…
A: Optimization model is type of model that solve different type of problem. The model have three…
Q: What is the genotype of individual 11? I II III 1 1 2 1 2 3 homozygous dominant heterozygous…
A: A key area of genetics is the study of inheritance patterns, which sheds light on the transmission…
Q: Give only typing answer with explanation and conclusion OmpC and OmpF are expressed differentially…
A: Outer membrane proteins (OMPs), such as OmpC and OmpF, are crucial for the function and integrity of…
Q: Analogs of nucleotides are often used in studies of DNA. An analog is a modification of one of the…
A: Nucleotide analogs, are alterations of typical bases that can be joined into DNA and afterward…
Q: How can an understanding of the human microbiome contribute to innovative strategies for health…
A: The human microbiome refers to the complex community of microorganisms that live on and within our…
Q: How does a physician's considerations shift when contemplating policy questions? she must only…
A: When a physician is providing care for an individual patient, their focus is on that patient's…
Q: Which group of eukaryotic organisms is most similar to plants?
A: 1. Eukaryotic organisms have nucleus within nuclear membrane.2. They had mitochondria .3. The…
Q: Give typing answer with explanation and conclusion Which of these is not one of the benefits of…
A: Sustainable soil, ecology, and human health are all benefits of organic agriculture. Instead of…
Q: or Explain N nced learning
A: Test-enhanced learning is a powerful educational approach that utilizes tests or quizzes as a means…
Q: Who manages the distribution of organs for transplant? The hospital the donor happens to be in…
A: In the United States, the distribution of organs for transplant is managed by the United Network for…
Q: If the binding activity was purified, suggest two experimental approaches that could be taken to…
A: There are numerous experimental techniques that can be used to confirm a purified protein's role as…
Q: If a molecule binds to an active site in an enzyme, but it is not involved in the reaction and is…
A: Correct answer: Competitive inhibitionExplanation:Competitive inhibition is a type of enzyme…
Q: How does the presence of genetic variation contribute to the resilience and adaptation of a species…
A: In order for a species to survive and adapt to changing environmental conditions, genetic variation…
Q: 1. QUESTION 24 The abuse of Salvia Divinorum by a woman prior to and during pregnancy Cis not…
A: Salvia Divinorum is a potent hallucinogenic plant that has gained attention for its psychoactive…
Q: A culture of E. coli is diluted as follows: (1) 65mL are added to 435mL of water. (2) 10uL from (1)…
A: DilutionIt refers to the process of reducing the concentration of a substance in a solution by…
Q: Describe how alcohol is absorbed and metabolized in the body.
A: Alcohol absorption and metabolism in the body is a complex process that involves various…
Q: summarise what changes must take place in the sperm and ovum to achieve fertilisation
A: Fertilization takes place in a series of various complex steps before the sperm reaches an ovum to…
Q: Compare through illustration homeostasis and allostasis
A: Two key physiological principles i.e, homeostasis and allostasis are essential for preserving…
Q: What evidence supports the existence of evolutionary lineages and their role in shaping…
A: Evolutionary lineages, also known as phylogenetic lineages, refer to the sequential…
Q: Which of the statements about bacteriophage is FALSE: a) specialized transduction is a low…
A: A bacteriophage, sometimes referred to as a phage colloquially, is a duplodnaviria virus that…
Q: Which of the following are true about human variation? (Choose all that apply): Group of answer…
A: The variety of genetic and phenotypic variations seen among members of a population are referred to…
Q: in . Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix.…
A: There are two types of nucleic acids present in our body, DNA and RNA. DNA or deoxyribo nucleic acid…
Q: If an organism's diploid number is 66, it's haploid number is
A: In many organisms, including humans, there are two types of cells: somatic cells, which make up most…
Q: 6. Sort the following molecules based on their rate of diffusion across the phospholipid bilayer in…
A: The phospholipid bilayer is made up of two phospholipid layers: an internal layer that repels water…
Q: In a Western blot or an ELISA, you are looking for visible clumps
A: ELISA (Enzyme-Linked Immunosorbent Assay) and Western blot are laboratory techniques used to detect…
Q: What recent advancements in hematology research have shed light on the role of non-coding RNA…
A: Non-coding RNAs (ncRNAs) are RNA molecules that are not translated into proteins, but perform a…
Q: You also obtained the MIC for a variety of common antifungals by testing them against a single…
A: The question addresses the efficacy data of a new antifungal product tested against Aspergillus…
Q: How does food insecurity affect the gut microbiome and its impact on human health?
A: The gut microbiome refers to the collection of microbes, including bacteria, viruses, and fungi,…
Q: What is autosomal pattern of Mendelian inheritance.? What disorder is caused by this pattern on…
A: Autosomal pattern of Mendelian inheritance refers to the inheritance of traits or disorders that are…
Q: A slice of material cut from an apple is an example of a homogeneous mixture heterogeneous mixture…
A: According to how uniform or non-uniformly the mixture's composition and attributes are distributed…
Q: what is the probability of them having a hemophiliac son?
A: HemophiliaHaemophilia is a recognised X-linked characteristic, which suggests that the "X"…
Q: Contrast density-dependent versus density-independent population processes.
A: Understanding population dynamics and the factors that influence them is crucial for studying…
Q: True or false A spectrophotometer is used to directly count the number of cells in a liquid…
A: Microbiology: The examination of tiny creatures' biology includes viruses, bacteria, algae, fungus,…
Q: Why does Carr spend so much time explaining the plasticity or the brain? How does this information…
A: Carr spends a lot of time explaining the plasticity of the brain because he wants to show that our…
Q: B14. The last two amino acids added to a polypeptide are - Trp - Glu - (C terminus). The last two…
A: To determine the last two anticodons used in the translation of the given polypeptide sequence, we…
Q: stores materials?
A: Inclusions, cytoskeleton, endospores, cell wall, and wax layer are different structures found in…
Q: Please add draw out the Eukaryotic cell (animal) and include a detailed key that indicates where…
A: Note: according to our answering guidelines, we are not supposed to provide references.Cells are…
Q: their understanding of the classification of organis A. From the five kingdoms listed below,…
A: Broad groupings are represented by phyla in the classification of living things. They are used to…
Q: 1. Imagine you are a student in Alfred Hershey and Martha Chase's lab in the late 1940s. You are…
A: DNA is a genetic material in almost all living organisms. DNA carries gene which passes from one…
Q: which of the following determine if there is sufficient machinery (enzymes/ proteins) to complete…
A: Cell Cycle:A growing cell undergoes a series of events in a cyclic manner. These events lead to cell…
Q: Explain why genetic diversity within a population is so vital to the survival of the species.
A: Evolution is defined as the gradual changes in the features and characteristics of organisms and…
Q: 3 2 4 5 KKK
A: The Figure 39.1 represents the sliding filament theory of skeletal muscle, which explains the…
Q: Answer the following questions based on the above (rainy season) data. 1. What was the general trend…
A: Note:- Sorry, question#3 cannot be answered as the hypothesis statement is not provided. Please…
Q: The following ingredient list represents which type of growth media? Beef extract 1.5 g Yeast…
A: Growth media, also known as culture media or nutrient media, are substances or mixtures used to…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- RNA shares with proteins the ability to fold intocomplex three-dimensional shapes. As a result, RNAmolecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of moleculescan act as enzymes, or biological catalysts). Thesestatements are not true of DNA. Why can someRNA molecules act as enzymes whereas DNAmolecules cannot? (Hint: Most RNA moleculesconsist of a single strand of nucleotides while mostDNA molecules are double helixes made of twostrands of nucleotides.)Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.Before the technology existed to synthesize RNAmolecules of defined sequence like those in Fig. 8.5,similar experiments were performed with syntheticmRNAs of undefined sequence. For example, RNAsconsisting only of Us and Gs could be synthesized invitro, but they would have random sequences. Supposea pool of random-sequence RNAs was synthesized ina reaction mixture containing three times as much UTPas GTP, and that the resulting RNAs were translatedin vitro.a. How many different codons exist in the RNAs?b. How many different amino acids would you find inthe polypeptides synthesized?c. Why are your answers to (a) and (b) not the same?d. How often would you expect to find each of thecodons in (a)?e. In what proportions would you expect to find eachof the amino acids in the polypeptides?f. If you did this experiment—that is, synthesizedrandom-sequence RNAs containing a 3:1 ratio ofU:G, and quantified the amount of each amino acidin the polypeptides produced—prior to knowledgeof the genetic…
- The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mu- tants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations- that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a single-base deletion at a nearby site. Shown below are portions of the amino acid sequence of wild-type T4 lysozyme and the putative double mutant. The remaining parts of the sequence were unchanged. Identify MRNA sequences that could encode each of these amino acid sequences and deter- mine whether your codon assignments are consistent with the genetic code. Wild-type ... Lys-Ser-Pro-Ser-Leu-Asn-Ala. .. Double mutant - ..…In describing the triplet binding assay, an undergraduate with limited knowledge of translation might say, “That should not work.” That statement makes sense. Explain why, and describe how researchers successfully performed this assay.A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
- Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structureAn important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations—that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a single-base deletion at a nearby site. Shown below are portions of the amino acid sequence of wild-type T4 lysozyme and the putative double mutant. The remaining parts of the sequence were unchanged. Identify mRNA sequences that could encode each of these amino acid sequences and determine whether your codon assignments are consistent with the genetic code.Wild-type …Lys–Ser–Pro–Ser–Leu–Asn–Ala…Double mutant …Lys–Val–His–His–Leu–Met–Ala…Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?