1. The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic codeexplains this?2. Describe two features of a tRNA molecule that allow it to function as an adaptor moleculeduring translation.

Name: 1. The AUC and AUA codons in mRNA both specify isoleucine. What featu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic codeexplains this?2. Describe two features of a tRNA molecule that allow it to function as an adaptor moleculeduring translation.

The AUC and AUA codons in mRNA both specify isoleucine. This feauture of the genetic code explains…

Science

Biology

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? Describe two features of a tRNA molecule that allow it to function as an adaptor molecule during translation.

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? Describe two features of a tRNA molecule that allow it to function as an adaptor molecule during translation.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG AUGCCCACG UAG a) Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site (E) Amino end of the newly synthesized polypeptide chain Carboxyl end of the newly synthesized polypeptide chain Approximate location of the next peptide bond that will be formed
1. how is the initiation codon, identified by the ribosomes during translation in:1. prokaryotes and 2. eukaryotes 2. aminoacly-tRNA synthetase joins amino acids to their cognate tRNAs. Breifely describe the 2 reactions of aminoacylation.
25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
1. Although aminoacyl-tRNA synhtetases make few errors, occasionally an error. How can these error be detected and corrected? 2. Describe how the base pairing between the Shine-Delgarno sequence and the 30S subunit provides a mechanism for distinguishing a start codon form a methionine codon. What is the eukaryotic version of this mechanism?
1. Describe at least four ways in which transcription is different from DNA replication. 2. Describe and differentiate among the primary, secondary, tertiary and quaternary structures of a protein. 3. What is the role of these two important enzymes during translation: aminoacyl-tRNA synthetase and peptidyl transferase? 4. Describe four specific characteristics of the genetic code?
1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
1. By use of a labeled diagram or a written description, distinguish the roles of thefollowing in elongation of a polypeptide: initiation complex, charged tRNAs, peptidyltransferase, Site A, Site P 2. What determines the initiation of translation? (Hint: there is more than one feature oftranslation.)
3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
20. TRNA stands for transfer RNA, since a tRNA molecule transfers an amino acid to the growing protein molecule. You could also think of tRNA as translation RNA. Explain how tRNA molecules help the ribosome to translate the sequence.of nucleotides in mRNA to i sequence of amino acids in a protein. To see the process of translation in action, watch "Translation" at https://www.biointeractive.org/classroom-resources/translation-basic-detail. 21a. Fill in the blanks to label each type of molecule in this figure. a.tRNA $ & 7 8 9.