2. For this diagram of transcription and translation in a bacterial cell - help explain the process by Identify which part is transcription and which is translation Label the 5' and 3' ends on the mRNA and DNA. a. b. C. Label the arrow with either the N (amino) termini of the protein being made or the C (carboxyl) termini of the protein being made. d. Label the template strand for transcription. e. On the DNA, box the three bases encoding the first amino acid of the protein being made. Box the approximate location on the RNA as well. f. Identify the part of the diagram where tRNAs would bind. 5 3' RNA Polymerase GGGCATGCGCCCTAC CCCGTACGCGGGA mRNA ribosome GGCATAAAGCTCCCCAGTTTGCGCGCGCATTGTGATG TGCCGTATTTCGAGGGO AAACGCGCGCGTAACACTAC Promoter

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: Transcription  The process of formation of RNA from DNA with the help of RNA polymerase.

Q: A promoter is, choose the correct answer... a. the binding site for the ribosome on a messenger RNA…

A: Transcription is a process in which a transcript ( RNA ) is formed. It takes place by the common…

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…

A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…

Q: 1.Describe the journey of a protein, from its synthesis to its final destination 2. Explain the…

A: Proteins are essential macromolecules that perform various functions within cells and organisms. The…

Q: трare step synthesis prokaryotes and eukaryotes. Consider in your answer DNA elements, major…

A: Transcription is the process in which RNA is synthesized with the help of DNA. RNA polymerase enzyme…

Q: 1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A.…

A: Introduction Genetic code or codon is a three letters nucleotide bases present on m RNA which code…

Q: Q. Ribosomes are “ribonucloprotein particles” in that they are composed mostly of rRNA with some…

A: Ribosomal proteins are made in the cytoplasm and then transported to the nucleus where they are…

Q: In a couple of sentences, explain how eukaryotic activator proteins (that are usually gene-specific…

A: Transcription factors are proteins that bind to neighbouring DNA and help switch particular genes…

Q: 1.This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

A: This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

Q: 3. Shown here is the structure of a human gene. = exons = introns Transcription termination site…

A: According to our guideline we can answer only first 3 subparts of a question. So, upload the…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…

Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…

A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.

Q: All of the following are functions of introns EXCEPT A. Provide buffering capacity against mutations…

A: Introns are non coding sections of RNA transcripts that are removed by splicing before the…

Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…

A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: 20. You are modelling a genetic circuit shown above on Simbiology. What would the Reaction Rate…

A: Simbiology is a software application that is used to model and simulate biological systems,…

Q: 1. Using the diagram below: a. Label the process identified by each arrow. b. Label the diagrams…

A: DNA stands for 'deoxyribonucleic acid'. It is the hereditary material in humans as well as in most…

Q: Select all the correct types of RNA that are both the product of transcription and are also…

A: RNA plays a very important role in biological processes and also acts as Genetic material in some…

Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…

A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…

Q: b. Translation translation is the process of generating polypeptide using the information carried on…

A: Flow of information in the DNA involves DNA RNA and proteins. Proteins are the ultimate machinery…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.