2. For this diagram of transcription and translation in a bacterial cell - help explain the process by Identify which part is transcription and which is translation Label the 5' and 3' ends on the mRNA and DNA. a. b. C. Label the arrow with either the N (amino) termini of the protein being made or the C (carboxyl) termini of the protein being made. d. Label the template strand for transcription. e. On the DNA, box the three bases encoding the first amino acid of the protein being made. Box the approximate location on the RNA as well. f. Identify the part of the diagram where tRNAs would bind. 5 3' RNA Polymerase GGGCATGCGCCCTAC CCCGTACGCGGGA mRNA ribosome GGCATAAAGCTCCCCAGTTTGCGCGCGCATTGTGATG TGCCGTATTTCGAGGGO AAACGCGCGCGTAACACTAC Promoter
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.


Trending now
This is a popular solution!
Step by step
Solved in 5 steps with 1 images









