8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exons and the lines are the introns in the gene a. b. Site 1 Site 2 Explain WHY. Site 3 a two base-pair deletion at Site 1 that removes two "G-C" nucleotide pairs from the gene sequence a single base-pair substitution at Site 2 that changes a tyrosine-encoding amino acid (TAC) to a stop codon (TAA) C. a single base-pair substitution at Site 3 that changes one alanine-encoding codon (GCC) to another (GCA) d. a single base-pair insertion at Site 4 that shifts the reading frame for subsequent codons Site 4

8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exons and the lines are the introns in the gene a. b. Site 1 Site 2 Explain WHY. Site 3 a two base-pair deletion at Site 1 that removes two "G-C" nucleotide pairs from the gene sequence a single base-pair substitution at Site 2 that changes a tyrosine-encoding amino acid (TAC) to a stop codon (TAA) C. a single base-pair substitution at Site 3 that changes one alanine-encoding codon (GCC) to another (GCA) d. a single base-pair insertion at Site 4 that shifts the reading frame for subsequent codons Site 4

Name: 8. Which of the following gene mutations is most likely to affect cor
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exonsand the lines are the introns in the genea.b.C.d.Site 1 Site 2Explain WHY.1+Site 3Site 4a two base-pair deletion at Site 1 that remo

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Related questions

Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 3. The DNA sequence of a gene coding for a short polypeptide is TACGCTAGGCGATTGACT. What would be…

A: Transcription is a process of formation of mRNA from DNA, whereas tranlation is a formation of…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: 1. You are studying an E. coli gene that specifies a protein. A part of its sequence is…

A: The mutation is a change in DNA sequence that is responsible for alternation of the amino acids in…

Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…

A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…

Q: It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the…

A: A ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA-binding protein.

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell…

A: * Sickle cell anemia is blood disorder in which red blood cells becomes mis shapen and turns into…

Q: 18. While studying a human patient with hemophilia, you have discovered that the second exon of the…

A: Transposable elements also are known as jumping genes. These are those DNA sequences that can change…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: A frameshift mutation in a gene is when nucleotide bases are added or removed in increments that are…

Q: 1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA…

A: Since you have asked multiple questions, we will answer first question for you. In order to get…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA is as follows_ 3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.

Q: . how is the initiation codon, identified by the ribosomes during translation in:1. prokaryotes and…

A: Introduction: 1. In prokaryotes, the initiation codon is identified by the ribosome by binding to…

Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…

A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exons
and the lines are the introns in the gene
a.
b.
C.
d.
Site 1 Site 2
Explain WHY.
1+
Site 3
Site 4
a two base-pair deletion at Site 1 that removes two "G-C" nucleotide pairs from the gene sequence
a single base-pair substitution at Site 2 that changes a tyrosine-encoding amino acid (TAC) to a stop codon (TAA)
a single base-pair substitution at Site 3 that changes one alanine-encoding codon (GCC) to another (GCA)
a single base-pair insertion at Site 4 that shifts the reading frame for subsequent codons

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Types of mutation

VIEW

Step 3: Explanation

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?
4
Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…
1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand,…
45. A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their replacement by two new bases. The deletion is shown below. AAG ↻Deleted bases The deleted bases are replaced by two guanine bases.The transcription of the mutated Duchenne muscular dystrophy gene described above results in the replacement of a Select one: a. lysine codon with a serine codon b. phenylalanine codon with a serine codon c. phenylalanine codon with an arginine codon d. lysine codon with an arginine codon
1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?
the following is a strand of a DNA
1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)
29. pre-MRNA transcript 5' 3' Open boxes represent introns Filled boxes represent exons A) Draw the MRNA to be translated if the pre-mRNA is constitutively spliced. S B) Draw an mRNA to be translated if the pre-MRNA is alternatively spliced due to exon skipping.
1. Shown below is the diagram of a eukaryotic gene that encodes a protein. The promoter and transcription start sites are indicated on the map. The numbers shown correlate with nucleotide base position along the DNA sequence. Transcriptional Transcription start site occurs at base position 1 terminator 5100 Promoter 5' Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3' 100 Positions 1100 2000 3000 4000 200-202 Start codon positions 4801-4803 Stop codon а. Where in the above sequence where RNA polymerase will bind? b. How long (in bases) will the primary mRNA transcript of this gene be? How long (in başes) is the processed mRNA transcript? С.
7. The diagram below represents the full mRNA transcribed from the trp operon under conditions of low tryptophan. Grey blocks indicate protein coding sequences. Annotate the diagram by indicating the expected positions of the elements listed below, add more detail to the diagram if required to allow you to accurately annotate it. Use only the letters A - H (e.g. "A" for structural genes). Where a label refers to a region, you must use a bracket to indicate the extent of the region in conjunction with the specific letter. A. Structural genes B. Leader peptide C. Two adjacent trp codons D. 5' UTR and 3' UTR E. Ribosome binding site F. Site of potential transcription termination from attenuation G. Regions with sequence complementarity H. Stretch of Us 5' EDC BA 3'