9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the corresponding sequence of MRNA nucleotides resulting from transcription of the sequence? a) AUGGUUGGAUGU b) ТАССААССТАСА c) UTGGYYGGUTGT d) ATGGTTGGATGT 10. Consult the genetic code chart below and consider the MRNA sequence you determined from the previous question. What would be the corresponding sequence of amino acids in a protein resulting from translation of the MRNA sequence? a) Val-Gly-Cys b) Met-Val-Gly-Cys c) Met-lle-Ala-Gly d) Cys-Gly-Val-Met

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: a prokaryote cell a molecule of mRNA that has a nucleotide sequence of CUAAUGGUUCC would use this…

A: Answer :: Option a) is correct that is 3, because   Proteins are made up from a set of 20 amino…

Q: 1) Describe the dna transcription-mRNA with all the step.

A: The discovery of DNA as genetic material is one of the most significant discoveries in molecular…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: 2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino…

A: Translation is a 2 step process where nucleotide sequence transcribed from DNA present inside…

Q: Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid…

A: Proteins are made up of amino acids and are necessary for the efficient operation of all living…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA.…

A: The translation is the process of using the genetic information in mRNA to create a protein. In the…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: A mini mRNA has the sequence 5'UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3'.  a) Use the genetic code to…

A: Messenger RNA (mRNA) is a type of single-stranded RNA (ssRNA) involved in protein synthesis. mRNA is…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: What is the function of the poly(A) tail that is added to mRNA in eukaryotic cells? a) to prevent…

A: During mRNA processing,there are several types of 3' modifications that can occur on mRNA, including…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.