Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid codes in your answer. 5' GGA UGG AAU UCC AAA AUC 3' Note: Reference the Genetic code table for additional information.
Q: What amino acid is coded by each codon? Note: Reference the Genetic code table for additional…
A: In molecular biology, the genetic code is the set of rules used by living cells to translate…
Q: Write the missing element in the following nuclear reactions. Include mass and atomic number. Type…
A: These are the common particles involved in nuclear reactions:(Image from Lumen Learning.…
Q: Consider the reaction shown, which of the following conditions is most likely to lead to the…
A: The catalytic conversion of pyruvate to acetyl-CoA by the enzyme pyruvate dehydrogenase is…
Q: 49 and 50
A: Question no. 49: The reaction involves a substitution reaction of a nitro-substituted benzene ring…
Q: uce the observations about each chemical reaction in the table below to decide the sign (positive or…
A: Reaction AObservation: The reverse of this reaction is always spontaneous but proceeds slower at…
Q: Consider a cell that requires much more ribose5-phosphate than NADPH. The cell needs ribose…
A: The question is asking about the metabolic fate of glucose 6-phosphate, glycolytic intermediates,…
Q: Answer the following questions about propane(C3H8), hexane(C6H14), and octane(CH₁8). Part 1 of 4…
A: Here's a step-by-step explanation for each part of the question:Part 1 : Highest Boiling…
Q: Consider this monosaccharide. H но -H H -OH но -H CH₂OH Part: 0 / 3 Part 1 of 3 Label the chirality…
A: A chirality center (or chiral center) in a molecule is a carbon atom that has four different groups…
Q: Part A For the reaction Br2 (1) 2 Br (g) at what temperature is the equilbrium constant equal to…
A:
Q: What is the mechanism of glass knives deteriorate? Please sollllllvvve this question briefly, thanks…
A: Step 1: Glass knives, often used in ultramicrotomy for cutting ultra-thin sections for electron…
Q: DRAW ON PAPER PLEASE - Amylose is a linear polymer of several thousand glucose units linked by (14)…
A: Amylose is a polysaccharide. It is made up of -D-glucose residues linked via (14) glycosidic linkage…
Q: The conversion of 1,3-bisphosphoglycerate (1,3-BPG) to glyceraldehyde 3-phosphate (GAP) represents a…
A: In the second half of glycolysis, GAP is converted to 1,3-BPG via an oxidation reaction. GAP being…
Q: Acetyl-CoA + HCO3- → Malonyl-CoA However, the ΔG of this reaction is much greater than zero. In…
A: The formation of malonyl-CoA from acetyl-CoA is an irreversible three-step process, catalyzed by…
Q: Consider the fructose-1,6-bisphosphatase reaction. Calculate the free energy change if the ratio of…
A: The objective of this question is to calculate the free energy change (ΔG) for the…
Q: Draw the major organic product obtained from the following sequence of reactions. 1.2 eq. CH3CH2MgCI…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Approach to solving the question: (a) To trace the course of [1,6-(C-14)-2,5-(C-13)]glucose through…
Q: A gas balloon has a volume of 82.28 liters when the temperature is 40.9 °C and the pressure is 799.3…
A: The first step is to convert the temperatures from Celsius to Kelvin because the gas laws are based…
Q: 4. Gentiobiose (D-Glc(ẞ1-6)D-glc) is a disaccharide found in some plant glycosides. Draw Haworth…
A: Gentiobiose has a beta-glycoside link, originating at C-1 in ring A and terminating at C-6 in ring…
Q: 1. List four classes of membrane-associated proteins and briefly describe the differences between…
A: FEEL FREE TO ASK FOR CLARIFICATIONS
Q: Define glycolysis, state its role, and list the 10 steps of glycolysis and the enzymes involved in…
A: Refer to the solution
Q: Describe the propagation stage of peroxidation reaction by showing peroxidation of oleic acid.…
A: Lipid peroxidation is a process that breaks down cell membranes and can cause cell damage and lead…
Q: What is the direct consequence of the hydrophobic effect that stabilizes the double helix
A: Approach to solving the question: Detailed explanation:In an aqueous environment, the hydrophobic…
Q: Estimate the total osmolarity of a 2-in-1 TPN bag containing D14W AA 6% plus 160 mEq KCl and 140 mEq…
A: Osmolarity is the number of solute particles per litre of the solution. First we determine the…
Q: An enzyme is mutated such that the KM of the mutated enzyme is lower than the KM of the original…
A: The objective of the question is to understand the effects of a mutation that lowers the KM of an…
Q: Estimate the viscosith of 1.0 vol % agarose gel solution if it took 58 minutes for 1500 base pairs…
A: In order to solve this problem, we need to first calculate electrophoretic mobility () during the…
Q: Which of the following statements is correct for the reaction catalyzed by chymotrypsin? ○ The…
A: For the reaction catalyzed by chymotrypsin, the correct statement is:The substrate carbon atom…
Q: Please sir solvvvve this question, and please write down the reference, thanks sir
A: Below is a more thorough breakdown of the general structures found in every biomolecule: 1.…
Q: Answer the following questions about the given triacylglycerol. Part: 0 / 3 Part 1 of 3 Type the…
A: Let's go through each fatty acid chain in detail:1. First Fatty Acid Chain:Structure Analysis:This…
Q: Draw the skeletal structure for the organic product(s) formed when the following alcohol is…
A:
Q: None
A: Answer well explained above
Q: please help with this
A: Option 1 (AUCAUUCUAUUGUCCUCCACC) brings change in which UGA (encoding Cysteine) becomes UCA…
Q: A stock solution has a concentration of 3.04 NE tf 29.4 mt. of the stack solution is cliluted to a…
A: We can apply the dilution formula to resolve the issue of determining the final concentration…
Q: Activity 1B: Identical or Non-identical? Direction: Complete the table below by classifying the…
A: Genotypes can be classified by examining the letters within the genotype.Homozygous dominant (AA):…
Q: Please help me fill out the boxes in the worksheet
A: The image represents a simplified overview of several interconnected metabolic pathways, including…
Q: Which of the following is not known to be involved in the process of assisted folding of proteins?…
A: 1 ) Disulfide interchange is not known to be involved in the process of assisted folding of proteins…
Q: Give the IUPAC name for each structure.
A: IUPAC NAME:1. FIRST COMPOUND IS METHYL PENTANOATE. The IUPAC name for the compound METHYL VELARATE…
Q: A chemistry student needs 70.0 g of dimethyl sulfoxide for an experiment. By consulting the CRC…
A: To solve this problem, we need to calculate the volume of dimethyl sulfoxide that the student should…
Q: Using the bond dissociation energy table from Brightspace, calculate the enthalpy change of the…
A: To calculate the enthalpy change (ΔH) of the given reaction, you'll need to use the bond…
Q: Highlight an amine functional group in phenylephrine. Use the red circle to highlight all implicit…
A: 1)The objective of the question is to highlight the amine functional group in phenylephrine by…
Q: Which of the following hydrogens is most acidic? a A b B с C 11 1 CH₂ A с
A: Answer: b. BExplanation:On removal of the B proton, a carbanion(conjugate base) will form. Higher…
Q: consider pyruvic acid with Ka = 1.4x10^-4. what initial molarity of pyruvic acid would be needed to…
A: The acid dissociation of pyruvic acid can be written asCH3COCOOH(aq)→CH3COCOO−(aq)+H+(aq) GivenpH…
Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…
A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…
Q: 11. List 2 polysaccharides that provide structure and strength. What is interesting about the…
A: The objective of the question is to identify two polysaccharides that contribute to structure and…
Q: Which statement about BPG's interaction with hemoglobin is correct? Group of answer choices BPG…
A: Here are the reasons why the other option is wrong: BPG binds to a specific part of the hemoglobin…
Q: What is the major organic product obtained from the following reaction? Ph 3 2 1. NaNH, 2. .Br Ph Ph…
A: Step 1:
Q: please help with this
A:
Q: Genome Wide Associated Studies: Question 7 options: use SNP arrays to…
A: Approach to solving the question: a thorough way of answering. I hope this helps! Detailed…
Q: 6. Describe the two structural domains of steroid hormone receptors and explain how these receptors…
A: Steroid hormone receptors are proteins that belong to the nuclear receptor family and play a crucial…
Q: Given that the protein Burger is found only in the blood of patients with Sillyitis, with the aid of…
A: The Enzyme-Linked Immunosorbent Assay (ELISA) is a powerful technique used to detect and quantify…
Q: A high KM will result in an efficient enzyme. A. True B. False Specificity constant = Kcat/ KM kcat…
A: The appropriate responses to your queries are as follows:A high KM will result in an efficient…
Step by step
Solved in 2 steps
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GDecode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'Using the genetic code below, decipher the following mRNA sequence. 5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part: 0 / 5 Part 1 of 5 What amino acid sequence is coded for by this mRNA? ☑Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
