Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented as boxes) are found in the mature mRNA. Transcription starts at the arrow labeled TSS, transcription stops at the line labeled TT, and the promoter location is indicated by the line. The indicated DNA sequences for two individuals are found within exon 2 as indicated, with Individual 2 having a mutation. Both sequences are in-frame with the upstream start codon. ATG ТАА Promoter (Start codon) (Stop codon) TSS TT Individual 1 5' ACAGGAGGAATAAGTTATGCA 3' Individual 2 5' ACAGGAGGAATAAGTTAAGCA 3 Part 1 You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the mRNA for Individual 1, you find that the MRNA for Individual 2 is more abundant. the same length. shorter. alternatively spliced. longer. o00 00

Q: Pharmacokinetics of cyclophosphamide

A: Pharmacokinetics is the term which describes the process that what our body does to a drug when the…

Q: Both a-keratin and collagen are fibrous proteins.however,the hydrogen bonding pattern is different…

A: Alpha keratins are intermediate filaments found in hairs, nails etc. Collagen is a structural…

Q: Why is ammonia highly toxic?

A: Ammonia toxicity occurs when individuals are exposed to external sources of ammonia via ingestion,…

Q: how did you detremine the ln(2)?

A: The concept of 'ln' is nothing but simple mathematics. We can simply type - 'ln 2' in a calculator…

Q: HO, NH2 HO This amino acid is called It's three-letter abbreviation is and its one-letter…

A: Proteins are the building blocks, made up of amino acids. They are of twenty different types that…

Q: sucrose + acid ------->

A: Sucrose is a disaccharide composed of glucose and fructose. In sucrose glucose and fructose are…

Q: 510. Trypsin cleaves proteins after lysine and arginine residues. Trypsin itself has 13 lysine and 2…

A: By cleaving peptide bonds in the protein sequence, protease catalyzes the hydrolysis of proteins…

Q: None

A: The equation you've provided represents the reaction between aluminum (Al) in its solid form and…

Q: what is lab value of creatinine

A: Creatinine is the breakdown product of creatine phosphate from muscle and protein metabolism .Serum…

Q: draw a punnett square for ggBB and GGBb.

A: The genotypes of an individual refer to the arrangement or the type of gene combination that an…

Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…

A: AThe rearrangement in scenario A is a tandem duplication, where the duplicated segment GH is…

Q: nal misfolded amyloid fibril

A: Protein misfolding may be a common cellular event which will occur throughout the time period of a…

Q: describe in words the structure of the DNA molecule.

A: DNA or Deoxyribonucleic acid is a nucleic acid that serves as the genetic material of almost all…

Q: WHich answer would be most correct for glyclosis?

A: Since it is the metabolic process by which glucose produces cellular energy, glycolysis is…