Answered: Which of these sequences has dyad…

Which of these sequences has dyad symmetry? O 5' AATGCTTATCGTAA 3' O More than one of the above O 5' TATGCTTATGCATA 3' O 5' AATGCTTATAATGC 3' O 5' AATGCTTATTTACG 3'

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter17: Biotechnology And Genomics

Section: Chapter Questions

Problem 7RQ: Bt toxin is considered to be. a gene for modifying insect DNA an organic insecticide produced by...

See similar textbooks

Related questions

Q: Return the triplet to its original state (ATG). Now change the second triplet from CCA Fo CCC. Check…

A: Synthesis of RNA from DNA is transcription and synthesis of protein from RNA is translation. when…

Q: The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: DNA Extraction using Tomato DNA Extraction by Mouthwash

A: DNA extraction is a technique for isolating DNA from cell membranes, proteins, and other biological…

Q: The pedigree shown is A) Autosomal Dominant B) Autosomal Recessive C) Sex linked recessive D) Sex…

A: A pedigree is a family chart showing the inheritance of a particular trait through several…

Q: Genetics Question 9

A: The objective of the question is to determine whether the statement that cystic fibrosis can be…

Q: mutation simulation

A: A silent mutation is a type of point mutation that does not change the amino acid sequence of the…

Q: Ch15 Hartwell genetics from genes to genomes

A: Mitochondria is an organelle present in eukaryotic cells that contains its own genetic material. The…

Q: Benefits and risks of Therapeutic Cloning

A: Therapeutic cloning is a process in which the nucleus of a cell ( basically the cell we like to…

Q: DNA RNA Chromosomes

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: The most common procedure for cloning an animal is __________.

A: Cloning is an assisted reproductive technology that permits placental breeders to form identical…

Q: how Deletions Remove DNA from the Genome

A: Deletion is a type of chromosomal aberrations in which a segment of chromosome is lost. It is of two…

Q: Biological functions of DNA

A: INTRODUCTION DNA is required for heredity, protein-coding, and delivering instructions for life and…

Q: Genetics Question 7

A: The objective of the question is to determine the genetic characteristics of the polydactyl trait in…

Q: Ten example of Human protein in therapeutic genetic technology that have available in genetic…

A: Genetic Engineering: Genetic engineering is the process of altering an organism's genetic makeup…

Q: Explain how this technology has changed the way Situations, examples, and/or scenarios where humans…

A: Gene therapy is the technology of changing the genes present in the DNA by using molecular methods…

Q: DNA figure

A: DNA is the genetic material of approximate all living organisms, the structure of the DNA is very…

Q: DNA Polymerase of E.coli has 3 enzymatic activities. One is a 5'- 3 exonuclease. 1. what is its…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Select all of the regulators of transcription that bind to DNA when an allosteric effector (inducer…

A: The regulators of transcription that bind to DNA when an allosteric effector is present. Allosteric…

Q: During metaphase of mitosis, a cell from this organism would have a) A single line of 3 chromosomes…

A: Mitotic metaphase is the stage in nuclear division where the chromosomes line up in a single line…

Q: Cytokinesis in Plant Cells • A plant cell has a rigid cell wall covering its cell membrane ( plasma…

A: When a parent cell divides into two or more daughter cells, this is referred to as cell division.…

Q: In humans, sickle cell anemia is an autosomal recessive disorder. There are two alleles at this…

A: it states that the allelic frequency of a random mating population does not change from generation…

Q: Genetics Question 8

A: The objective of the question is to determine whether the given statement about expressivity in…

Q: importance of the role of genetics in society today

A: Genetics is a branch of biology that deals with the heredity and variation of organisms. Genes are…

Q: Transformation and sequence validation of the clones

A: DNA cloning is a technique of molecular biology. It is used to generate identical copies of a piece…

Q: Genetics Question 1

A: The objective of the question is to determine the possible inheritance patterns of a trait based on…

Q: Genetics Question 2

A: The objective of the question is to determine the type of genetic inheritance pattern that would…

Q: (3)What type of inheritance is shown in the pedigree above

A: 1.AUTOSOMAL DOMINANT Does not skip generations.Affected parents can have unaffected…

Q: how to extract DNA from everything

A: Extraction of DNA from a specimen is a process by which nuclear DNA can be extracted from the cell…

Question

molecular genetics

Which of these sequences has dyad symmetry?
O 5' AATGCTTATCGTAA 3'
O More than one of the above
O 5' TATGCTTATGCATA 3'
O 5' AATGCTTATAATGC 3'
O 5' AATGCTTATTTACG 3¹

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Explanation

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

By using those sequences to explain the tiling path for each sequence
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
Please don't provide handwriting solution
The complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5 CAUAUUGGGAGGAAU 3 O 5' UAAGGAGGGUUAUAC3' O 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'
In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?
What do the asterisks (*) denote in the alignment? (Mention 2 points at least)
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the previous question, starting at the second base.
plz explain with thorough explanation
Primer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgcccccc