First part is right need help with the second part please Ⓒ Macmillan LearningA solution contains DNA polymerase and the Mg2+ salts of dATP, dGTP, dCTP, and TTP.When added to aliquots of the solution, which of the following DNA molecules would lead to DNA synthesis?a single-stranded closed circle containing 1000 nucleotide unitsa double-stranded linear molecule of 1000 nucleotide pairs with a free 3'-OH group at each enda double-stranded closed circle containing 1000 nucleotide pairsa single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free3'-OH terminusIdentify the reasons why the DNA molecule you selected would lead to DNA synthesis.It is double-stranded DNA.It has a primer with a free 3'-OH group.It has an available template strand.ATP supplies the energy required.

An important characteristic of DNA replication is that it is semiconservative. Two strands of DNA…

Identify the reasons why the DNA molecule you selected would lead to DNA synthesis. It is double-stranded DNA. It has a primer with a free 3'-OH group. It has an available template strand. ATP supplies the energy required.

Identify the reasons why the DNA molecule you selected would lead to DNA synthesis. It is double-stranded DNA. It has a primer with a free 3'-OH group. It has an available template strand. ATP supplies the energy required.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Identify the type of inhibition (competitive, noncompetitive, uncompetitive) 1 Enzyme B Inhibitor…

A: Introduction: Enzyme kinetics involves the study of the rate of chemical reactions increased by a…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GCATAAT-3'

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: [1,6-(C-14)-2,5-(C-13)]glucose Trace the course of through glycolysis and the TCA cycle. You need…

A: Carbon tracing is the method by which we trace the path taken by each carbon atom in a substrate, as…

Q: Which of the following is not a denaturing agent for proteins? Addition of heavy metals Addition of…

A: Denaturation modifies the molecular structure of a protein by breaking the weak bonds responsible…

Q: After you collect the reaction data, at time O the positive control absorbance is 0.92 and after 24…

A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…

Q: What are ketone bodies? How are they formed? What makes carboxylic acids acidic? Define the…

A: ketone bodies act as a source of energy under glucose and fat-deprived conditions. They are secreted…

Q: Phosphonacetyl-L-aspartate (PALA) is a potent inhibitor of aspartate transcarbamoylase because it…

A: Enzymes are biocatalysts that catalyse biochemical reactions. They contain an active site where the…

Q: The following is a block diagram where the building blocks are labeled with letters and the linkages…

A: Introduction Lipids are the organic compounds are nonpolar molecules which are soluble only in…

Q: multimeric protein contains 20 or greater different amino acid residues At least 2 or more…

A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…

Q: Which of the choices are types of posttranslational modifications a newly synth choices that apply.…

A: Posttranslational modifications are the amino acid side chain modification in some proteins…

Q: Identify the following structures in a DNA molecule:

A: The four types of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…

Q: Using proper convention, provide the amino acid sequence for the following protein. O H₂N-CH- CH₂…

A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…

Q: For an enzyme-catalyzed reaction, the velocity was determined at two different concentrations of the…

A: The velocity of an enzyme catalyzed reaction is given by: V=Vmax×SKM+SWhere,V=velocity of the…

Q: Consider the following reaction occurring at 298 K: OH CH₂OH OH -0. OH +ATP OH k₁ k₂ 0- -0-CH₂ to OH…

A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…

Q: Most enzymes have optimum operating conditions to function at maximum rate or velocity. Some of…

A: Enzymes are proteins, which accelerate the rate of biochemical reactions. Each enzyme has an optimum…

Q: Which type(s) of chromosomal aberrations is/are likely to cause semisterility? Select all correct…

A: Introduction Any change in chromosome number and chromosome structure can cause various genetic…

Q: Arrange the events of replication chronologically from A (first) to G (last event): -Sealing of…

A: Replication is the process in which duplication of DNA takes place inside the nucleus. this process…

Q: The enzyme thiolase catalyzes one step in the ß-oxidation of saturated fats. One portion of the…

A: Fatty acids are transported into the cell. The enzyme fatty acyl-CoA synthase(FACS) adds a CoA group…

Q: B PART III Multiple choice 16. What is a protein's primary structure? a.) polypeptide sequence (b)…

A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…

Q: OH H Almost 30% of the cocoon of the parasitic beetle Larinus DH maculatus consists of the…

A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…

Q: There are eight chemical reactions that occur in the citric acid cycle process. The reactions of…

A: The Krebs cycle or citric acid cycle occurs in the mitochondria and provides electrons for oxidative…

Q: The TPOX locus is one of the genetic loci used for forensic analysis of DNA. The TPOX locus has the…

A: Forensics DNA profiling can be used to solve old or unsolved crimes and to identify the person…

Q: Refer to the titration curve in answering the questions: 13 12 11 10 9 8 7 6 5 4 3 0 2 4 6 ← 8 10 12…

A: A titration curve is used to study the pH changes that occurs during the titration of an acid with a…

Q: Provide the reagents used and the positive result to test the following nutrients

A: Nutrients are organic and inorganic substances needed by living cells to grow and survive. Some of…

Q: The heme group is a prosthetic group in: OA) Fetal hemoglobin B) Adult hemoglobin C) Myoglobin D) a…

A: Hemoglobin and myoglobin are globular proteins that have the ability to bind molecular oxygen.…

Q: Which amino acids are exclusively ketogenic? lysine leucine tyrosine isoleucine arginine

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: General equation of anaerobic oxidation of glucose.

A: Energy is released from the breakdown of glucose molecules via a process called cellular respiration…

Q: 4. Blood glucose level, glucose transporter proteins (classification, localisation and biological…

A: Blood Glucose is the major sugar found in our blood.It is the main source of energy used by a cell.…

Q: Explain why both ATP and NADPH are required for the operation of the Calvin-Benson-Bassham cycle,…

A: Calvin-Benson-Bassham cycle is commonly known as Calvin cycle or Dark reactions of photosynthesis,…

Q: Pathological changes in the liver and brain were found in a 27-year-old patient. A diagnosis was…

A: Wilsons disease is causes due to accumulation of copper to accumulate in your liver, brain and other…

Q: explain adenocarcinoma and carcinoid tumors in detail Provide examples.

A: Cancer is deadly disease in which cells of body grow uncontrollably and spread to different parts of…

Q: Can you write possible mineralization and biotransformation reactions for glucose (C6H12O6) ?

A: Biotransformation is the biochemical process (metabolism) taking place in some life form that alters…

Q: 5. Matching Type Match Column A with Column B. Write your answer on the space provided. CAPITAL…

A: All living things go through the necessary process of respiration, which involves using oxygen and…

Q: Why is derivatization (i.e., transesterification) of triglycerides or lipids to fatty acid methyl…

A: Triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are linked to one…

Q: each a-ß pair are held together by disulfide bonds, these dimers are held together by hydrogen bonds…

A: Hemoglobin is an oxygen carrying protein in the body. A hemoglobin molecule is composed of four…

Q: BIOC 384 What would be the long-term effects if ATCase remained in the inactive T state?

A: ATCase(aspartate transcarbamoylase) is an allosteric enzyme that participates in the pyrimidine…

Q: Fructose 1,6-bisphosphatase (FBPase) is a key enzyme in gluconeogenesis. The mammalian enzyme is…

A: Gluconeogenesis is a process in which glucose is synthesize from non-carbohydrate sources like…

Q: QUESTION 21 The causes of excess ketone bodies in the urine include all of the following EXCEPT…

A: The excess ketone bodies in the urine causes ketonuria also called as ketoaciduria. Ketones are…

Q: True or False: Spectrophotometric assays always track the rate of reaction through a. True b. False…

A: Spectrophotometry is the method that uses light beam to measure the concentration of a chemical or a…

Q: Zoey Wong is a research officer at the Department of Biosciences of Tunku Abdul Rahman University…

A: The basic principles of the central dogma of molecular biology is similar in both prokaryotic and…

Q: Signaling by tyrosine kinase receptors is generally associated with all of the following except: OA)…

A: A hormone is a class of signaling molecules in multicellular organisms that are sent to distant…

Q: (a) The pyruvate dehydrogenase complex and the a-ketoglutarate dehydrogenase complex have common…

A: PDH (Pyruvate dehydrogenase) and alpha-ketoglutarate dehydrogenase complexes both contain 3…

Q: 7. Imagine you're purifying a protein with a pl of 6.5 that has a 6-Histidine tag from E. coli…

A: Ni-NTA agarose is an affinity chromatography matrix that is used for the purification of recombinant…

Q: A molecule that is required by enzymes in order for the enzyme to be active is called a OA)…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: Our assay had two reactions, one catalyzed by glucose oxidase, and the second by peroxidase. What…

A: Enzyme kinetics assays (or simply Enzyme assays) are carried out to determine the kinetic parameters…

Q: The ff: table showed data of enzyme catalytic reaction. The rate of reaction (v) decreased with the…

A: Inhibitor constant (Ki ) is the equilibrium dissociation constant of the Enzyme-Inhibitor complex…

Q: 3. Consider the reaction: H3C-(CH₂) H H C—C—C—SCOA HH H3C-(CH₂) a. What kind of reaction is being…

A: The given molecule is a fatty acyl CoA. Fatty acids are highly reduced and provide energy in the…

Q: Question 9 Briefly discuss the discovery and development of selective inhibitors of sodium-glucose…

A: Sodium-glucose linked transporters (SGLTs) , or to be more specific Sodium-glucose linked…

Q: Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid…

A: There are hundreds of different amino acids however only 20 different amino acids participate in…

Q: Which of the following describes the interaction between the amino acid last eluted and the anion…

A: In Ion exchange chromatography the molecules are separated according to their charge. The matrix…

Question

100%

First part is right need help with the second part please

Ⓒ Macmillan Learning
A solution contains DNA polymerase and the Mg2+ salts of dATP, dGTP, dCTP, and TTP.
When added to aliquots of the solution, which of the following DNA molecules would lead to DNA synthesis?
a single-stranded closed circle containing 1000 nucleotide units
a double-stranded linear molecule of 1000 nucleotide pairs with a free 3'-OH group at each end
a double-stranded closed circle containing 1000 nucleotide pairs
a single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free
3'-OH terminus
Identify the reasons why the DNA molecule you selected would lead to DNA synthesis.
It is double-stranded DNA.
It has a primer with a free 3'-OH group.
It has an available template strand.
ATP supplies the energy required.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Recall that:

VIEW

Explanation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Given the active site diagram below, please identify the residue participating in a charge-charge interation. HO OH HN OH 5 ΝΗ *HN ΝΗ OH O Zn²+ 2 4 5 3 1 2 NH 3
AKS 5b: Which statement is correct regarding the semiconservative nature of DNA? * The semiconservative nature of DNA allows for genetic stability in somatic gene production MRNA operates as a template to allow DNA to replicate itself using ribosomes The structure of the phosphate group on the DNA molecule direct the correct nucleotides into place during replication Nucleotides in each original strand serve as a template for the new strand to be made AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * * AA AA AA AA АВ ВА AA BB AA AA АВ АС Figure A Figure B Figure C Figure D
Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
a. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.
What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0
Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I
19. Match the letters with the enzymes and macromolecules involved in DNA replication: A E B DNA POLYMERASE CATALYZES COMALENT LINKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND INCOMING NUCLEOSIDE D' TRIPHOSPHATE PAIRS WITH A BASE IN THE TEMPLATE STRAND A) i) pyrophosphate (Pi) ii) template strand ii) incoming nucleoside triphosphate iv) new strand v) DNA polymerase