Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in length. The DNA sequence of the lilP gene is shown below. 5'-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACTAGaaatattatttaa-3' 3'-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGATCtttataataaatt-5'

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and…

A: Introduction: RAG 1 & 2 are the recombination activating genes that encode a portion of a…

Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…

A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…

Q: please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the…

A: Ans: Chain termination sequencing: It is sanger sequencing method developed by Frederick sanger. The…

Q: You are working with a laboratory strain of E.coli that contains a 10 base-pair deletion in the Lac…

A: Introduction of the concept: The given concept is based on the lac operon in E.coli. The operon…

Q: Below are 9 possible primer pairs. Determine which primer pair is the best choice by considering the…

A: Introduction :- Primers are short oligonucleotide sequence which are required for starting or…

Q: 4.08 2.54 H Note: E E 1.02 1.02 1.67 H = EXON = INTRON AE E 10.8 kbp 3.94 3.66 E = EcoRI site H =…

A: Autoradiography is a method that visualizes molecules or fragments of molecules that have been…

Q: name and briefly describe two methods you could use to identify the changes in DNA sequence found in…

A: DNA mutations can have a wide range of consequences, including the development of genetic disorders,…

Q: A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to…

A: in agarose gel electrophoresis we separate DNA bands based on their size.

Q: explain: The kelch repeat domain in the problem in-line" or "plug-in" type domain.

A: Protein is a type of biomolecule. It is made up of a polypeptide chain, which is a chain of amino…

Q: How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript?

A: A consensus coding sequence (CDS) is a method used in next-generation sequencing (NGS) to identify…

Q: A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently…

A: The peptide sequence YSPTSPS is a known phosphorylation site that corresponds to the heptad repeat…

Q: Assume that a DNA sequencing reaction is carried out, except that the four different…

A: Ans: DNA sequencing: It is the process of knowing the sequence of the DNA. The DNA sequencing is of…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment),…

A: Agarose gel electrophoresis is mainly used for nucleic acid separation due to its large pore size…

Q: For tailed PCR primers the "tails" can have sequence that is NOT complementary to the target…

A: PCR - (polymerase chain reaction) is used to amplify the DNA sequence through repetitive cycles. It…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Following the spill of a mixture of chemicals into a small pond, bacteria from the pond are tested…

A: When a chemical spill occurs, particularly in a biologically dynamic environment like a pond, the…

Q: The consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is…

A: For Cas9 to work, it additionally requires a particular protospacer adjacent motif (PAM) that…

Q: What is the length in basepairs of these sequences? How many base substitutions are there between…

A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…

Q: Estimate the time needed for E. coli RNA polymerase at 37 °C to transcribe the entire gene for a…

A: Introduction: E.coli is a kind of bacteria that typically lives in your intestines. They are mainly…

Q: A closed circular plasmid B-DNA (10.5 bp/turn) consists of 231 base pairs and has    Wr= -1…

A: DNA Supercoiling --DNA supercoiling refers to amount of twist in a particular DNA Strand, which…

Q: In a cotransformation experiment (see question 4 of More GeneticTIPS), DNA was isolated from a donor…

A: Co-transformation occurs when the two or more genes are located in very close proximity that they…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are…

A: Chain terminating sequencing is also known as Sanger sequencing which is based on amplification of…

Q: What are the consequences for a DNA sequencing reaction if the ratio of dideoxyribonucleoside…

A: Introduction  DNA is composed of nucleotides arranged in a specific sequence. Prior knowledge of DNA…

Q: Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... |…

A: In bioinformatics, sequence alignment is a process by which two or more sequences are arranged to…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: The DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm.…

A: The mutation is the change in the nucleotide base pairs or in the DNA sequence which can be because…

Q: ven though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA…

A: Answer: EUKARYOTIC GENOME is more complex and larger than PROKARYOTIC GENOME beacuse prokaryotic…

Q: You are studying the regulation of a bacterial gene (TolU) that encodes an enzyme that is necessary…

A: First, let's start with a definition. Promoter: It is the sequence of DNA that is required to turn…

Q: Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct…

A:

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…

A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…

Q: The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to…

A: Transcription is the molecular process of synthesis of RNA from DNA. The genetic code of DNA is…

Q: In reversible terminator sequencing, how would the sequencing process be affected if the…

A: The basic between sanger's sequencing and reversible terminator sequencing is that Sangar's based on…