Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be most similar to each other? [at least mention 2 points]; Why? [at least mention 2 points] Image of the protein sequences :

Q: For each individual on gel, determine if the individual is homozygous for presence of the Alu…

A: In gel electrophoresis the fragments which are Small os size ( less base pairs) travel further in…

Q: For each individual on each gel, determine if the individual is homozygous for presence of the Alu…

A: An Alu element is a short stretch of DNA originally characterized by the action of the Arthrobacter…

Q: A hypothetical protein found in humans, chimpanzees, and orangutans has the following sequences.…

A: Dashes '-' show sequence deletions; underlined variations 'Y' and 'K' between the species indicate…

Q: Attatched is shown a boxshaded sequence alignment of Horse (top line) and myoglobin (second line).…

A: The introduction provides an overview of the questions related to the significance of the black,…

Q: 2. Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'- OH…

A: Forward primer:A primer that binds to antisense or plus strand of DNA is called as forward…

Q: determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-),…

A: Each Alu sub family member assertion locus was assayed by PCR analysis. It is done by using…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: A very common molecular biology research method is to analyze cell or tissue homogenates by…

A: In molecular biology research, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: A common strategy for identifying distantly relatedhomologous proteins is to search the database…

A: Introduction: Bioinformatics is an interdisciplinary field of science that combines biology,…

Q: Why a multiple sequence alignment is needed for researchers? What inferences can be derived from…

A: When three or more biological sequences are aligned and studied together, it is referred to as…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: Although the Shine-Dalgarno sequences vary considerably in differ- ent genes, they include examples…

A: Introduction: The small piece of DNA that code for protein referred as genes. It is the functional…

Q: Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein…

A: The Smith-Waterman algorithm uses local sequence alignment to find similar regions between two…

Q: Ladder LS KT MV DY JY Ladder 850 bp 550 bp 11 1

A: Gel electrophoresis is the technique that is used to determine the genotype by looking at the…

Q: SDS-PAGE and Agarose gel electrophoresis can both be used to separate proteins or protein- complexes…

A: Given Values: SDS-PAGE bands = 86 kD and 136 kD Agarose gel band = 222 kD and 444 kD

Q: What is the length in basepairs of these sequences? How many base substitutions are there between…

A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…

Q: Estimate the time needed for E. coli RNA polymerase at 37 °C to transcribe the entire gene for a…

A: Introduction: E.coli is a kind of bacteria that typically lives in your intestines. They are mainly…

Q: What is the principle behind the very specific sequence in donning and doffing PPEs? Explain

A: PPE -- refers to the personal protective equipments which help against the spread of infection and…

Q: For two homologous sequences (S1 and S2) with a JC69 distance (D), compute the expected proportion…

A: The rate at which mutations happen is the only variable in the widely used JC69 model of sequence…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: You have been given an unknown low weight polypeptide to sequence. Luckily, you have a plentiful…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 1a) In MALDI-TOF data, when performing peptide mass mapping search,  the peptide masses and the…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is…

A: The genome is the entire DNA content (in base pair) of a haploid (n) cell. That means in case of a…

Q: explanation

A: To restore a protein's normal function after a frameshift mutation, the reading frame must be…

Q: This figure comes from an article about predicting protein structures with a multiplayer online ame…

A: Based on the figure and the descriptions you have provided, here is a summary of the trends and…

Q: 1) In MALDI-TOF data, when performing peptide mass mapping search, a) The number of peptides…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: Construct a multiple protein sequence alignment using human HOXD13 and 9 other orthologues of human…

A: All the 4 proteins are paralogous because they are decants from the same ancestor group but they…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and…

A: Nucleotides are composed of a phosphate group, a pentose sugar, and a nitrogenous base. The pentose…

Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…

A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…

Q: Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... |…

A: In bioinformatics, sequence alignment is a process by which two or more sequences are arranged to…

Q: Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: Protein folding is driven by chemical and physical constraints. As a polypeptide chain folds into a…

Q: Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct…

A:

Q: The coding sequence of genes that specify proteins with the same function in related species…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which of the following sequences would pair best with this sequence: 5'-CGATTCGA-3' O 5'-UCGAAUCG-3'…

A: In DNA, the nitrogenous bases adenine (A) pairs with thymine (T), and cytosine (C) pairs with…

Q: Discuss the main similarities and differences in the nucleic acid sequencing methods known as…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: In reversible terminator sequencing, how would the sequencing process be affected if the…

A: The basic between sanger's sequencing and reversible terminator sequencing is that Sangar's based on…

Q: Based on the alignment of these protein sequences, which [pairs] of the genes appear to be most…

A: The provided data seems to involve a sequence alignment analysis, possibly for identifying the most…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.