2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT cCA CAG ACA * AGU AAA GGU GUC UGU 3. Translate the MRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart

Q: 9. The following DNA sequences found on the sense strand belong to the same eukaryotic gene:…

A: DNA or Deoxyribonucleic Acid acts as the genetic material of biological entities. It is made up of…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand

A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).

Q: Second letter of codon U U UC UA UG U CU CC CA CG First letter of AU AC AA AG codon (5'-end) GU GC…

A: The genetic code may be defined as a collection of principles that living cells use to translate…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: For #74 and # 75, convert the DNA sequence into mRNA, and then the mRNA into protein (amino acids).

A: DNA and RNA are the two forms of genetic material, found in most living organisms. DNA is…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: For each of the amino acids below, write the sequence of the single tRNA anticodon that could pair…

A: DNA ( Deoxyribonucleic acid) is two stranded structure which serves as genetic material in most of…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…

A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…

A: A codon is a three-nucleotide (tri-nucleotide) sequence of DNA or RNA that corresponds to a specific…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino…

A: Trancription It refers to the process of copying the genetic sequences of DNA into mRNA. Translation…

Q: The queation on my assignment is select the description of an exon? the answers they give are: 1.…

A: An exon is a coding region of the gene that codes for amino acids. In eukaryotes, genes are made up…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: 5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help…

A: A. The polypeptide generated by the given RNA sequence is "Met-Pro-Thr-Asp-Trp-Pro."b. The mutation…

Q: A newly discovered gene has th 4.08 2.54 el H H 1.02 ↓ E E 1.67 E 10.8 kbp 3.94 3.66 H 10.811 E E…

A: (a) A method used frequently in labs to separate charged molecules like DNA, RNA, and proteins is…

Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…

A: Genes are hereditary structures on genetic material. These control some specific particular traits.…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: transcribe and translate the following using the codon chart: DNA TAC CCC AAG CTC GGT ATC

A: During transcription, C is replaced with G, G with C, T with A and A with U. Also, tRNA contain…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.