Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…
A: The sequence of protein is usually notated as a string of letters, according to the order of the…
Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…
A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…
Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…
A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…
Q: 39 The Central Dogma describes the flow of genetic information as follows: Select an answer and…
A: DNA are genetic material which consist of genetic information that needs to passed from one…
Q: Describe the process of translating mRNA into proteins. Be sure to also include the following key…
A: The translation is known as a process in which protein is synthesized through the mRNA (transcribed…
Q: In cells, proteins are synthesized from a gene sequence via the process of transcription and…
A: In prokaryotes cell organelles are absent. The genomic DNA of prokaryotes is found in the cytoplasm.…
Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…
A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…
A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…
A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…
Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…
A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…
Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…
A:
Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…
A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG The corresponding DNA sequence will be…
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…
A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…
Q: Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use…
A: The genetic material of the cell contains various genes that code for various proteins. This happens…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…
A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…
Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…
A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…
Q: Use the following DNA sequence, and write the resulting messenger RNA sequence
A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…
Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…
A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…
Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…
A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…
Q: What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3'…
A: Proteins are complex biomolecules made up of chains of amino acids that fold into specific…
Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…
A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…
Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…
A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…
A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…
Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…
Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…
Q: Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one…
A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…
Q: In a single strand of DNA, is it ever possible for the number of adenines to be greater than the…
A: In a DNA molecule purine always pairs with a pyrimidine base. Adenine is a purine base and thymine…
Q: State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3'…
A: Introduction :- A codon is a sequence of three nucleotides (A, C, G, or T) that encodes for a…
Q: Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write…
A:
Step by step
Solved in 2 steps
- You are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
- Format Tools Table Window Help dit View Insert A A SU E D - Expression activities (1 Com Design Layout >> Tell me Sare Commen Insert Draw Font Paragraph Styles Dictate Sensitivity For each example, fill in the template strand DNA sequence, mRNA codons, tRNA anticodons, or amino acid sequence. If several sequences might work choose any one. Use the figures in your book for cross mapping. Answer the questions on the second page on a separate paper. 1. DNA MRNA AUG АCU A G C U G G G G G UAU U A C UUUUAG tRNA AA 2. DNA TAC C GC T C C G C C GT C GACA A T A C C ACT MRNA tRNA AA 3. DNA MRNA tRNA UA C CAC C Cc C GU AUG G CU A AU A UC G G G AA 4. DNA MRNA TRNA AA МЕТ ARG GLY PHE PHE МЕТ VAL GLY (STOPDirections: Transcribe the DNA sequence in the space provided. Use your notes and what you know. Remember, what pairs with A? With C? DNA sequence: ACСА СТА ССТ СТС АТT MRNA sequence: UGU GAU Directions: Now use the codon chart to translate the mRNA sequence into an amino acid chain. Second letter A G UUUPhe UAU Tyr UCU UCC UCA UCG UGU UGCCYS UAA Stop UGA Stop A UUC UAC Ser UUA UUG Leu UAG Stop UGG Trp G CAU CGU] CUU CUC CUA CUG CCU CCC CCA CCG His CAC CAA Gin CGC Leu Pro CGA Arg A CAG CGG AAU Asn ACU ACC ACA AUG Met ACG AGU ser AGC AGA Arg AUU AUC Fle AAC Thr AUA AAA AAGLYS AGG. G GGU GGC GCU) GAU GUU GUC GUA GUG GAC Asp GAA GCC Ala GCA Gly Val GGA A GCG Glu GGG GAG, Amino acid sequence:Cys + Asp First letter Third letterSay you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read? Edit Vicw Inscrt Format Tools Tablc Paragraph BIUA 2 T 12ptv
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GUsing the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________Place sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGMutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________