Use the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme ß-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threonine

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: Translate the given amino acid sequence into one-letter code.…

A: Genetic codons are long enough to be taken in account in research purposes. So as for such, some…

Q: Vasopressin & oxytocin are hormones produced by the posterior pituitary gland.  Both hormones are…

A: Vasopressin, also called antidiuretic hormone, the hormone that plays a key role in maintaining…

Q: Subjecting this peptide to trypsin would result in L-M-F-V-W-E-Q-A-P-S-P OA Lys and…

A: Trypsin is an enzyme that break peptide bond has a specific site of cleavage.

Q: Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids…

A: Translation is the process by which the protein is synthesized by reading the codons in mRNA. The…

Q: A ribozyme is a catalytic protein that assists in the processing of tRNA.   Question 1 options:…

A: Ribozymes are defined as RNA (ribonucleic acid) enzyme that are capable of catalyzing a chemical…

Q: small protein has a sequence ACNCKAAPMLCARYCAMLH. The structure of this single peptide is stabilized…

A:

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: What is the base sequence of the segment of DNA that is responsible for the biosynthesis of the…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Ribonucleotide reductase converts UDP into dUDP. True Or False

A: Ribonucleotide reductase is an enzyme which helps in the process of DNA synthesis, by synthesis of…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: One way to control metabolic pathways, or other conditions that involve proteins, is to regulate the…

A: The lac operon is a genetic system found in bacteria that regulates the metabolism of lactose. It…

Q: T/F: This reaction probably produces NADH in a cell O True CH2OH -ОН O False Н но-н Н Н -ОН -OH…

A: Few important points : Nucleic acids and proteins are informational biomolecules. Amino acids will…

Q: Which amino acid pair constitutes the hydrophobic patch on sickle cell hemoglobin that results in…

A: Sickle cell disease is caused due to inversion of one base pair (A -> T). Due to which, the sixth…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…

A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…

Q: figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards…

A: In this process first of all RNA sequence could be find out by the genetic code. Later on  sequences…

Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the…

A: Dystrophin is a protein that helps keep muscle cells intact.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.