A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for this protein: Phe Ala Met Ser Thr Leu Val

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein

A: Sequence of nucleotide in mRNA  AUGCGUUCAUGGACU is given .

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Write a possible mRNA sequence that codes for each of the following peptides. a. Met–Arg–His–Phe c.…

A: There are 64 different codons of which sixty-one codon codes for specific amino acids, four…

Q: The genetic message to make a  specific amino acid in a protein, is carried by a specific   three…

A: Gene is a segment of DNA (deoxyribonucleic acid)/RNA (ribonucleic acid), which codes for a protein…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: List the 4 types of protein modification and describe each in 1 sentence

A: Protein modification refer to any change in the chemical composition of proteins following…

Q: In human, translation begins before transcription of an mRNA completes. T/F

A: The central dogma of molecular biology states that exciting DNA molecule in the cell undergoes…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: The exact start site for protein synthesis on the mRNA is AUG and base pairs with a tRNA carrying…

A: A codon is a sequence of three nucleotides (adenine, cytosine, guanine, or uracil) in DNA or RNA…

Q: Molecule Structure, Function diagram or description TRNA Ribosome MRNA poly-a tail

A: Transcription is the process of synthesis of RNA from DNA, using DNA as a template. It is initiated…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the…

A: Each aminoacyl-tRNA synthetase's active site functions as a "lock and key" for an associated tRNA…

Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…

A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…

Q: A small section of mRNA codons has the following sequence: UGU  GGU  CAA  CCG Some Amino Acids…

A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…

Q: Describe the structure of a polysome, which is depicted.

A: Ribonucleic acid (RNA) is a genetic material that plays a vital role in ribosome and protein…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Q: How many amino acids would be in this protein? Which of the five types of nitrogen bases is not…

A: Four types of aminoacids would be in this protein   UCU--Serine AUU--Isoleucine GGG---Glycine…

Q: What term is used to describe the sequence on the tRNA that is complementary to mRNA?…

A: Ribonucleic acid (RNA) are genetic material of some viruses. They are of three types mRNA, rRNA and…

Q: Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to…

A: RNA is a type of nucleic acid present in the cells.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.