Write the polypeptide sequence that would be translated from your mRNA sequence. Use single-letter amino acid codes. The image presents a codon chart, which is used to determine the amino acid specified by a triplet of mRNA bases during the process of protein synthesis. The chart is divided into sections based on the three nucleotide bases (first, second, and third) of the codon. Here's a detailed transcription:### First Base- **U (Uracil)** - UUU, UUC: Phenylalanine (F) - UUA, UUG: Leucine (L) - UCU, UCC, UCA, UCG: Serine (S) - UAU, UAC: Tyrosine (Y) - UAA, UAG: Stop codons - UGU, UGC: Cysteine (C) - UGA: Stop codon - UGG: Tryptophan (W)- **C (Cytosine)** - CUU, CUC, CUA, CUG: Leucine (L) - CCU, CCC, CCA, CCG: Proline (P) - CAU, CAC: Histidine (H) - CAA, CAG: Glutamate (Q) - CGU, CGC, CGA, CGG: Arginine (R)- **A (Adenine)** - AUU, AUC, AUA: Isoleucine (I) - AUG: Methionine, start codon (M) - ACU, ACC, ACA, ACG: Threonine (T) - AAU, AAC: Asparagine (N) - AAA, AAG: Lysine (K) - AGU, AGC: Serine (S) - AGA, AGG: Arginine (R)- **G (Guanine)** - GUU, GUC, GUA, GUG: Valine (V) - GCU, GCC, GCA, GCG: Alanine (A) - GAU, GAC: Aspartic acid (D) - GAA, GAG: Glutamic acid (E) - GGU, GGC, GGA, GGG: Glycine (G)This chart guides the translation of mRNA sequences into proteins by providing the corresponding amino **DNA Sequence Analysis**The image presents a DNA sequence indicated by its 5’ to 3’ directionality: **5’ CTATAAGGCGCAAATCCCTGCCCAT 3’**The sequence is annotated with colored arrows and numbers to indicate specific nucleotides:1. **Arrow 1 (Blue):** Points to the third 'C' in the sequence, located in the segment "AAATCCCT".2. **Arrow 2 (Red):** Points to the 'C' in "GCAAAT", showing a specific nucleotide position.3. **Arrow 3 (Purple):** Highlights the first 'G' in "GCGC", indicating another point of interest.4. **Arrow 4 (Green):** Focuses on the 'G' in "TGCC", demonstrating yet another significant position.Each arrow is color-coded and numbered to ensure clarity when referring to specific bases in educational contexts. Understanding these annotations aids in analyzing mutations or modifications at precise locations within the DNA strand.

Answer - The DNA sequence will be - 5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3' GATATTCCGCGTTTAGGGACGGTA 5' - Template strandmRNA sequence will be - 5' CUA UAA GGC GCA AAU CCC UGC CAU 3' Polypeptide sequence will be - LEU STOP GLY ALA ASN PRO CYS HIS In single letter code, it will be - L (STOP) G A N P C H The polypeptide sequence will contain a stop codon in second position.