Write the polypeptide sequence that would be translated from your mRNA sequence.

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…

A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use…

A: The genetic material of the cell contains various genes that code for various proteins. This happens…

Q: Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so,…

A: The RNA is formed from the DNA by the process of transcription. The protein is formed from the RNA…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…

A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…

Q: AKS 5c1: The model below represents the process of protein synthesis. What is the best description…

A: Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…

Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…

A: Introduction:  DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: Choose any pentapeptide composed of five different amino acids.  List the amino acids.  Present the…

A: A pentapeptide is a chain of five amino acids connected together via a peptide bond. A protein chain…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…

A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction   Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: Assume that the following mRNA segment has been translated.   5’-UACCGAAUGUCU-3’   Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…

A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…

Q: Translation is the process by which the sets of 3 bases (codons) of the MRNA are read to specify the…

A: The translation is a process through which the mRNA gets translated into polypeptide chains. The…

Q: Refer to the information on the genetic code. Use this information to determine how many amino acids…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…

A: Ans is.. methionine

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: The translation is one of the two processes by which gene expression takes place. Gene expression…