Homework Help is Here – Start Your Trial Now!
Science
Biology
Write the polypeptide sequence that would be translated from your mRNA sequence.

Write the polypeptide sequence that would be translated from your mRNA sequence.

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

Write the polypeptide sequence that would be translated from your mRNA sequence. Use single-letter amino acid codes.

The image presents a codon chart, which is used to determine the amino acid specified by a triplet of mRNA bases during the process of protein synthesis. The chart is divided into sections based on the three nucleotide bases (first, second, and third) of the codon. Here's a detailed transcription: ### First Base - **U (Uracil)** - UUU, UUC: Phenylalanine (F) - UUA, UUG: Leucine (L) - UCU, UCC, UCA, UCG: Serine (S) - UAU, UAC: Tyrosine (Y) - UAA, UAG: Stop codons - UGU, UGC: Cysteine (C) - UGA: Stop codon - UGG: Tryptophan (W) - **C (Cytosine)** - CUU, CUC, CUA, CUG: Leucine (L) - CCU, CCC, CCA, CCG: Proline (P) - CAU, CAC: Histidine (H) - CAA, CAG: Glutamate (Q) - CGU, CGC, CGA, CGG: Arginine (R) - **A (Adenine)** - AUU, AUC, AUA: Isoleucine (I) - AUG: Methionine, start codon (M) - ACU, ACC, ACA, ACG: Threonine (T) - AAU, AAC: Asparagine (N) - AAA, AAG: Lysine (K) - AGU, AGC: Serine (S) - AGA, AGG: Arginine (R) - **G (Guanine)** - GUU, GUC, GUA, GUG: Valine (V) - GCU, GCC, GCA, GCG: Alanine (A) - GAU, GAC: Aspartic acid (D) - GAA, GAG: Glutamic acid (E) - GGU, GGC, GGA, GGG: Glycine (G) This chart guides the translation of mRNA sequences into proteins by providing the corresponding amino
Transcribed Image Text:The image presents a codon chart, which is used to determine the amino acid specified by a triplet of mRNA bases during the process of protein synthesis. The chart is divided into sections based on the three nucleotide bases (first, second, and third) of the codon. Here's a detailed transcription: ### First Base - **U (Uracil)** - UUU, UUC: Phenylalanine (F) - UUA, UUG: Leucine (L) - UCU, UCC, UCA, UCG: Serine (S) - UAU, UAC: Tyrosine (Y) - UAA, UAG: Stop codons - UGU, UGC: Cysteine (C) - UGA: Stop codon - UGG: Tryptophan (W) - **C (Cytosine)** - CUU, CUC, CUA, CUG: Leucine (L) - CCU, CCC, CCA, CCG: Proline (P) - CAU, CAC: Histidine (H) - CAA, CAG: Glutamate (Q) - CGU, CGC, CGA, CGG: Arginine (R) - **A (Adenine)** - AUU, AUC, AUA: Isoleucine (I) - AUG: Methionine, start codon (M) - ACU, ACC, ACA, ACG: Threonine (T) - AAU, AAC: Asparagine (N) - AAA, AAG: Lysine (K) - AGU, AGC: Serine (S) - AGA, AGG: Arginine (R) - **G (Guanine)** - GUU, GUC, GUA, GUG: Valine (V) - GCU, GCC, GCA, GCG: Alanine (A) - GAU, GAC: Aspartic acid (D) - GAA, GAG: Glutamic acid (E) - GGU, GGC, GGA, GGG: Glycine (G) This chart guides the translation of mRNA sequences into proteins by providing the corresponding amino
**DNA Sequence Analysis** The image presents a DNA sequence indicated by its 5’ to 3’ directionality: **5’ CTATAAGGCGCAAATCCCTGCCCAT 3’** The sequence is annotated with colored arrows and numbers to indicate specific nucleotides: 1. **Arrow 1 (Blue):** Points to the third 'C' in the sequence, located in the segment "AAATCCCT". 2. **Arrow 2 (Red):** Points to the 'C' in "GCAAAT", showing a specific nucleotide position. 3. **Arrow 3 (Purple):** Highlights the first 'G' in "GCGC", indicating another point of interest. 4. **Arrow 4 (Green):** Focuses on the 'G' in "TGCC", demonstrating yet another significant position. Each arrow is color-coded and numbered to ensure clarity when referring to specific bases in educational contexts. Understanding these annotations aids in analyzing mutations or modifications at precise locations within the DNA strand.
Transcribed Image Text:**DNA Sequence Analysis** The image presents a DNA sequence indicated by its 5’ to 3’ directionality: **5’ CTATAAGGCGCAAATCCCTGCCCAT 3’** The sequence is annotated with colored arrows and numbers to indicate specific nucleotides: 1. **Arrow 1 (Blue):** Points to the third 'C' in the sequence, located in the segment "AAATCCCT". 2. **Arrow 2 (Red):** Points to the 'C' in "GCAAAT", showing a specific nucleotide position. 3. **Arrow 3 (Purple):** Highlights the first 'G' in "GCGC", indicating another point of interest. 4. **Arrow 4 (Green):** Focuses on the 'G' in "TGCC", demonstrating yet another significant position. Each arrow is color-coded and numbered to ensure clarity when referring to specific bases in educational contexts. Understanding these annotations aids in analyzing mutations or modifications at precise locations within the DNA strand.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS