Once a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (tRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAA

Q: 69. Which of the following statements about RNA splicing is false? A) Introns are not found in…

A: RNA splicing permits numerous functional mRNAs to be produced from a single transcript that codes…

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…

A: Replication, transcription, and translation are used by all cells to keep track of their genetic…

Q: A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete…

A: The eukaryotic DNA is composed of coding and non-coding sequences, almost 90% are non-coding…

Q: Several common antibiotics affect some strains of bacteria's ability to carry out transcription…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: doctoral student in biology, Esther Mensah, is reviewing primary literature over RNAi interference…

A: AML gene I.e., Acute Myeloid Leukemia are the cancerous cells which might be the result mutations…

Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…

A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

A:

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: Using what is known about the location of introns, a methylguanosine cap, and a poly-A tail, the…

A: Answer.  In eukaryotes, transcription, and translation take place in different compartments of…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: Eukaryotes modify mRNA with an m7G cap: an  N7-methylated guanosine linked via a 5′ to 5′…

A: Post transcriptional capping refers to the attachment of an enzymatically appended cap on the 5'…

Q: a gene sequence has two poly-A sites, one in the center and one at the end, we can isolate mRNA with…

A: Poly-A refers to the poly-A tail which is at the 3'-end of oligonucleotides consisting of a…

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: The following is a sample primary RNA transcript. What must first occur before it can be translated?…

A: Introduction Transcription Is The Process Of Copying Information From A Strand Of DNA Into A New…

Q: b) In eukaryotes, the newly synthesized mRNA undergoes modifications before it is transported across…

A: In eukaryotic cells, transcription is a process in which genetic information in the DNA is converted…

Q: Hetero Nuclear RNA or hnRNA is the unmodified transcript. What process cuts out pieces of this RNA…

A: Gene expression is the phenomenon by which information in the DNA is translated to produce a…

Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?

A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…

Q: In eukaryotes there is not a consistent relationship between the length of the coding sequence of a…

A: DNA is 2.2 m long molecule in human beings.  It is converted to mRNA via process of transcription.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.