The following is a sample primary RNA transcript. What must first occur before it can be translated? Exon 1 - Intron 1 - Intron 2 - Exon 2 - Intron 3 i) Exons need to be removed ii) Introns need to be removed iii) Poly A tail needs to be added to the 3' end iv) Poly A tail needs to be added to the 5' end v) 5' cap needs to be added O i, i, iv O i, iv, v ii, iii, v O ii, v

The following is a sample primary RNA transcript. What must first occur before it can be translated? Exon 1 - Intron 1 - Intron 2 - Exon 2 - Intron 3 i) Exons need to be removed ii) Introns need to be removed iii) Poly A tail needs to be added to the 3' end iv) Poly A tail needs to be added to the 5' end v) 5' cap needs to be added O i, i, iv O i, iv, v ii, iii, v O ii, v

Name: The following is a sample primary RNA transcript. What must first occ
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following is a sample primary RNA transcript. What must first occur before it canbe translated?Exon 1 - Intron 1 - Intron 2 - Exon 2 - Intron 3i) Exons need to be removedii) Introns need to be removediii) Poly A tail needs to be added to the 3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Similar questions

Incorrect statement about m-RNAa) Cap is added to the 5’ endb) Introns are removed and exons are spliced togetherc) Histone mRNAs lack 5’ capd) Poly-A tail is added to the 3’ end
a) DNA fragment with instructions b) code c) is transcribed but not translated d) non-coding e) sometimes encoding sometimes not gene, 5' UTR, exon, intron, ATTATT
A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOP
A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP
If the following piece of DNA were used as a template for transcription, what would the sequence of the new RNA strand be? Template: 5'-GACATAGAA-3' 5'-UUCUAUGUC-3' 5-TTСТАТGTС-3' 5'-CUGUAUCUU-3' 5-СTGTATСTT-3
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 2 EboV Strain 2 (Circle the mutated bases) TCA TGT CAG CAA CTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
What is the mRNA made using the template/non-coding strand DNA sequence 5'-GTCGTAAT-3' O 5-CAGCAUUA-3' O 5'-GUCGUAAU-3' O 5'-UAAUGCUG-3' 5'-AUUACGAC-3' O 5'-CUCGUAAU-3' Question 11 as a/an
In eukaryotes the primary RNA transcript is converted to mRNA by Adding a cap Adding a tail to the end Removing the introns Adding cap and adding a tail to the end All of the above
1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence, transcribe this gene i.e a) write out that sequence of the mRNA you will make from turning on this gene Z b) Label the 5' and 3' ends of the mRNA made 2) Assuming there is a ribosome binding site for the mRNA you just synthesized in the previous question, write out the amino acid sequence of this protein Z that is made (Using the genetic discord Mary provided) The following double stranded DNA sequence provided contains a gene for making proteins Z. The regulatory sequence or switch is indicated by the Red colored sequences. Start of transcription is 10 nucleotide after the switch sequence beginning at the Blue region. Answer the following questions. 3'. TATGACAACGCGTATAATCCAGTCGGTTTGGGGGTAATTGGGCGTCCTACGTCTACAAAGGGTCGTT ААТAGCATTTAGGCGTсTGCCTTTTAТCGTTTATCGAATTтсТТАТTАTTTTAATстCсT...5 5'.ATACTGTTGCGCATATTAGGTCAGCCAAACCCCCATTAACCCGCAGGATGCAGATGTTTCCCAGCAAT…
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’