Identify the correct recognition site for ribosomal subunit binding during translation. the 30s subunit binds to the 7-methylguanosine cap at the 3’ end of eukaryotic mRNA the 60s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eubacterial mRNA the 40s subunit binds to the 7-methylguanosine cap at the 5’ end of eukaryotic mRNA the 70s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eukaryotic mRNA the 50s subunit binds to the 7-methylguanosine cap at the 3’ end of eubacterial mRNA

Q: Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before…

A: The transcription is the process by which RNA is produced from DNA. In case of eukaryotic mRNA, it…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: The transcription is intended to generate an RNA copy of the DNA sequence for the gene. The RNA…

Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…

A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…

Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…

A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA.  The…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are  primer widely used for cDNA the synthesis generation of a high frequency of…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…

A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Q: The following is a portion of an mRNA sequence:   3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…

A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…

Q: Identify one mistake that was introduced in the following figure.  True or false? The first few…

A: Since it is the method through which DNA is utilized as a template to produce RNA, transcription is…

Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…

A: Introduction:  DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…

Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.

A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…

Q: The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature…

A: In molecular biology, RNA splicing is the process by which a newly synthesised precursor messenger…

Q: What is the function of the AAUAAA sequence near the 3’ end of a eukaryotic pre-mature mRNA?     It…

A: AAUAAA is a short unique sequence that is basically required for the accurate and proper cleavage of…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: Microbiologists describe the processes of transcription and translation as “coupled” in bacteria.…

A: DNA serves as a genetic material and carries genetic information from one generation to another. DNA…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: A segment of template DNA is known to contain the following base sequence: 3'…

A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…

Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…

A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…

Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule…

A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains…

Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…

A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive…

A: The translation is a process through which the polypeptide chain is synthesized based on the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.