tRNA charging -Amino acid - IRNA Ribosomal -Anticodon subunits UAC Large Start codon 5' AUGCCCACGACUGCGAGCGUUCCGCUAAGGUAG 3' MRNA Small Stop codon Initiation UAC AUGCCCACGACUGCGAGCGUUCCGCUAAGGUAG 3' 5' E PA Elongation Charged - TRNA AAAA, UC UCGCAA AUGCCCACGACUGCGAGCGUUCCGCUAAGGUAG 5' 3' E PA Termination Termination Release factor UCG AUGCCCACGACUGCGAGCGUUCCGCUAAGGUAG 3' 5' E PA Peptide release Completed polypeptide AUGCCCACGACUGCGAGCGUUCCGCUAAGGUAG 3' Conclusion: Through the process of translation, amino acids are linked in the order specified by the MRNA. 15.21 Translation requires tRNA charging, initiation, elongation, and termination.

Q: Discuss the process of eukaryotic transcription in details please.

A: Transcription is a process in which RNA is synthesized from the template strand of DNA. Like any…

Q: What makes it possible to correctly start translation from an mRNA having multiple codons for…

A: Methionine is the amino acid which codes for AUG codon usually.Translation is the process in which…

Q: Discuss the two steps involved in RNA processing. Please explain each step in 2-3 sentences only.

A: In Eukaryote, mRNA produced during the transcription process is known as pre-mRNA. They undergo…

Q: In Figure 9-12(b), what do you think happens to the tRNA that is released from the E site?

A: The polypeptide chain-containing tRNA in the A site will shift to the P site, and the empty tRNA in…

Q: "Kindly answer this and make an explanation. That will be my reviewer."

A: Transcription is the process of making an RNA copy of a gene sequence. This copy is called as mRNA…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Genetic mutations can generate a PTC and elicit NMD in several ways: directly by generating a…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…

A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…

Q: RNA _________ Causes Gene Inactivation by Destroying the Corresponding mRNA.

A: RNA interference RNA interference(RNAi) is a mechanism that inhibits gene expression at the stage…

Q: Please describe the four-step process of the elongation during protein translation in bacteria.

A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…

Q: Write a possible sequence for an mRNA segment coding for apamine

A: Introduction  Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Hemophilia -- It occurs in about 1 of every 5000 males .     Usually a inherited disorder in which…

Q: List three molecular changes that take place in the processing of eukaryotic mRNA.

A: Eukaryotic mRNA goes through several changes before translating into protein. This s done to ensure…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key…

A: mRNA which stands for messenger RNA is a molecule responsible for production of amino acid chain…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the…

A: Dystrophin is a protein that helps keep muscle cells intact.

Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…

A: Exons are coding sequences and introns are the non-coding sequences. Splicing is the process of…

Q: Read the images attached before answering the following question. Explain the meaning of the numbers…

A: Cells, the most fundamental and vital unit in all living things, are made up of them. Cells are in…

Q: Carries a protein-building message select answer Transports and delivers specific amino acids to…

A: mRNA is the type of RNA that carries a protein building message. It is transcribed from DNA. It is…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: (Theme 5) You are studying the role of a gene called stop. When expressed, stop appears to inhibit…

A: If we consider that the stop gene encodes a small RNA, it might function through a process known as…

Q: Please draw the mature mRNA (before it is ready to be exported from nucleus):

A: In addition to their role in genetic information storage and transmission, nucleic acids are also…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: List the steps in the processing of a typical eukaryotic mRNA precursor to prepare it for its…

A: Primary transcripts are formed during transcription. This primary transcripts undergoes alterations…

Q: In Figure 9-12, is the terminal amino acid emerging fromthe ribosome encoded by the 5′or 3′end of…

A: Translation is a process by which amino acids are linked together by peptide bonds thereby forming…

Q: The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or…

A: Mature-messenger RNA often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…

A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…