Consider the following mRNA sequence: 5'-UUG ACC GAC-3'.Note: Reference the Genetic code table for additional information.Part 1 of 5What amino acid sequence is coded for by this mRNA?Leu-Thr-AspPart 2 of 5What is the amino acid sequence if a mutation converts UUG to UUA?Leu-Thr-AspPart 3 of 5What is the amino acid sequence if a mutation converts ACC to AGC?Leu-Ser-AspPart: 3/5Part 4 of 5What is the amino acid sequence if a mutation converts GAC to CACT

The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Answered: Consider the following mRNA sequence:…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT Leu-Thr-His Part: 4/5 Part 5 of 5 What is the amino acid sequence if G is added to the beginning of the chain? x S
Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part: 0 / 5 Part 1 of 5 What amino acid sequence is coded for by this mRNA? ☑
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning