This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1) 1)Which strand is the template strand for transcription? a)top b) bottom 2)What elements allowed you to identify the template strand? (Select all that apply) a)An ATG toward the 5' end ("upstream"} from the TSS b)The template strand has the 3' end on the left side. c) An ATG toward the 3' ("downstream") from the TSS d) The template strand is "read" by the polymerase from its 3' to 5' end. 3)What is the sequence of the mRNA transcribed from this gene? a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’ b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’ c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’ d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’ 4) Write the sequence of the amino acids produced from this mRNA by matching the boxes in the gold circles with the correct terms. Also label the beginning (N-) and end (C-) termini. You do not have to fill all the circles; begin at the leftmost circle. (Shown in image 2)
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1)
1)Which strand is the template strand for transcription?
a)top
b) bottom
2)What elements allowed you to identify the template strand? (Select all that apply)
a)An ATG toward the 5' end ("upstream"} from the TSS
b)The template strand has the 3' end on the left side.
c) An ATG toward the 3' ("downstream") from the TSS
d) The template strand is "read" by the polymerase from its 3' to 5' end.
3)What is the sequence of the mRNA transcribed from this gene?
a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’
b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’
c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’
d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’
4) Write the sequence of the amino acids produced from this mRNA by matching the boxes in the gold circles with the correct terms. Also label the beginning (N-) and end (C-) termini. You do not have to fill all the circles; begin at the leftmost circle. (Shown in image 2)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
