Match the mutation with the correct name. Not all labels are used. Nonsense Mutation Mismatch mutation Silent Mutation Missense Mutation Frameshift mutation 5' 3' TTT UUT TGT TGC ACA ACG L -> Į Į UGU UGC Į - .TGT. Cysteine Wild type TGC- TGG ACC UGG 3' 5' T TGA ACT UGA DNA Mutation Transcribed codon Amino acid translated Outcome

Match the mutation with the correct name. Not all labels are used. Nonsense Mutation Mismatch mutation Silent Mutation Missense Mutation Frameshift mutation 5' 3' TTT UUT TGT TGC ACA ACG L -> Į Į UGU UGC Į - .TGT. Cysteine Wild type TGC- TGG ACC UGG 3' 5' T TGA ACT UGA DNA Mutation Transcribed codon Amino acid translated Outcome

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer
For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG