elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit holighotned ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative mRNA sequence with four or more changes that would translate to the same amino acid sequence.

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: 14. Which mutation would be more harmful to a cell? For each predict the outcome of each mutation…

A: In order to base-pair with the correct codon on the mRNA during protein synthesis, the anticodon is…

Q: O 3'-GTA-CAG-CCG-CGT-5' ) 5'-CAC-GUC-GGC-GCA-3' 3'-CAT-GTC-GGC-GCA-5"

A: His-Val-Gly-Ala His= CAC Val=GUC Gly=GGC Ala=GCA   these amino acids get coded by other codes too,…

Q: 2.- Draw a step by step diagram of the translation process then explain what is happening in each…

A:

Q: er by ingle es the the ein will slation Which statement correctly describes proteins? O A…

A: Protein is made up of amino acids, which experts call them as the building blocks. Our body needs…

Q: Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA…

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: 4. Match the terms on the left with those on the right: AUG dihydrouridine Esite

A: Above given in the match the following are the terms involved in the translation process studied in…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: 1- Write the mature mRNA for both sequences, indicating both the 5' and 3' ends. Use the diagram…

A: 1. mRNA Sequence for Wild type Hemoglobin: 5' UACUAAUCGA AAAUUGCAGA CUGUAAUGGA CUGUAAUGGU GCACCUGACU…

Q: Can you explain it?

A: If the mRNA sequence is given, we can find out the amino acid sequence by looking at the genetic…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: 28) Use this model of a eukaryotic transcript to answer the following questiofn. E = exon and I=…

A: Exons- They are coding sequences present on the primary mRNA transcript as well as the mature mRNA.…

Q: 24. Use the table below to answer the following question. The template strand of a gene contains…

A: The DNA molecules are double stranded in structure . The DNA structure undergoes the process of…

Q: IIT TTC amino acid sanon TTA TTG CTT СТС СТА СТG phenylalanine ATT АТС АТА leucine GTT GTC GTA GTG…

A: Sense strand of DNA- 5'-CATCCAAATTGTTGCCCG-3' Antisense strand of DNA-  3'- GTAGGTTTAACAACGGGC-5'…

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…

A: Translation is a process of formation of protein from mRNA. This process takes place in the…

Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…

A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…

Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…

A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…

A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…

Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA…

A: Francis Crick proposed the central dogma which states that the DNA is replicated to produce DNA…

Q: Imagine that an mRNA molecule, with the following sequence of bases was translated by a ribosome: 5'…

A: Translation is the process of decoding genetic information encoded in messenger RNA (mRNA) to create…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Give typing answer with explanation and conclusion…

A: The production of RNA from DNA is known as translation that occurs within the nucleus of eukaryotic…

Q: Use the following figure to determine the amino acids that correspond to the mRNA sequence: 5' CAC…

A: The mRNA codons can be read from the figure by finding the first base of the codon on the left side…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: Match the given step with the major central dogma event being referred to.

A: The translation is the process of synthesis of protein from mRNA transcript. It occurs in the…

Q: Which of the following DNA mutations is almost certain to result in a shorter than normal protein?

A: In the present circumstance, we possess a DNA sequence and its equivalent mRNA sequence. It is…

Q: 39) Use the following information to answer the question. A part of an MRNA molecule with the…

A: Introduction-  The genetic information of living organisms is stored in the cell in the form of DNA.…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: The following drawing represents simultaneous transcription and translation in E. coli. Answer the…

A: We all know that central dogma is a very basic procedure to produce proteins.But there are several…

Q: PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting…

A: We are authorized to answer one question at a time since you have not mentioned which question…

Q: uestion 12 of 30 > Attempt 2 5'-GGU-3',5'-AAG-3',5'-IAC-3',5'-UGU-3', and 5'-CAA-3'. Give all A…

A: Step 1:The small RNA molecule transfer RNA (tRNA) is required for protein synthesis. Transfer RNA…

Q: Please put the following steps of eukaryotic protein synthesis in order from first (1) to last (4)…

A: The process of gene expression in the cell occurs via the mechanisms of Replication, Transcription,…

Q: Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: Here we are given the 3'→5' directing strand of the DNA . This strand is the template strand. During…

Q: Match the given step with the major central dogma event being referred to. An enzyme covalently adds…

A: Addition of 7-methyl guanosine triphosphate to the 5' end of pre-mRNA is a post transcriptional…

Q: A part of an mRNA moled charged transfer RNA molecules (with their a the mRNA so that a dipeptide…

A: Translation is the process by which a polypeptide chain (protein) is produced from mRNA within the…

Q: 15. Given the following (the start of a very long MRNA sequence), Val GUA GCA GCG GAA GAG Glu GA GUG…

A: A codon table can be used to translate a genetic code into an amino acid sequence. The standard…

Q: 36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting…

A: RNA is formed by the transcription process with the help of the DNA template strand and RNA…

Q: 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an…

A: answer The tRna with which amino acid attached will enter A site will be  CCC codon which codes for…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.