6 Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can berecognized by the TRNA anticodon ICG. (note: answer all possibilities)DA UGAQUESTION 1OB.CGUOC CGAOD UGCDE CGCQUESTION 3Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the RNA".O TrueO False

Name: 6 Following the 5-> 3' conversion of writing nucleotide sequence, indi
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 6 Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can berecognized by the TRNA anticodon ICG. (note: answer all possibilities)DA UGAQUESTION 1OB.CGUOC CGAOD UGCDE CGCQUESTION 3Anti-codon is

Answered: Image /qna-images/answer/f7d83022-15f5-4ead-85e1-a8effbb233a2.jpg

Science

Biology

Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can be recognized by the TRNA anticodon ICG. (note: answer all possibilities) DA UGA OB.CGU OC CGA ODUGC DE CGC QUESTION 3 Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the tRNA". O True O False

Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can be recognized by the TRNA anticodon ICG. (note: answer all possibilities) DA UGA OB.CGU OC CGA ODUGC DE CGC QUESTION 3 Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the tRNA". O True O False

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: 30 29 27 26 25 24 23 21 22 20 19 18 17 16 1 15

A: From the mouth to the anus, the digestive system is made up of a collection of hollow organs…

Q: Ap intergumery systems

A: The human body is a complicated system that consists of many sub-systems that help to keep it…

Q: When part of a nucleotide in a nucleic acid chain, which of the following may base pair with uridine…

A: Uridine is a major form of pyrimidine nucleotide, from which cytosine and uracil are derived. It is…

Q: IDENTIFY THE INTERNAL INTERCOSTALS A B A D C B D

A: The intercostal muscles are a gathering of muscles situated between the ribs in the rib cage. These…

Q: A

A: The parathyroid gland is a small but major endocrine gland present in the neck of humans. Humans…

Q: I letters

A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…

Q: diathroses

A: The study of joint is termed as arthrology. A joint or articulation is a point of contact between…

Q: Name 1 living thing

A: The organisms which are able to grow, reproduce and motile in nature(movement) etc.. are considered…

Q: Answer- 0

A: We know that cellular respiration is the process in which breakdown of food will take place and it…

Q: CH3CO3H

A: The given reaction is a reaction of ketone and per acid. The product of this reaction is an ester.…

Q: 1°What components of the plasma membrane might you drug interact with? Explain can use as many…

A: The given chemical formula is of drug - Atorvastatin. It is a lipid lowering drug which is a statin…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can be
recognized by the TRNA anticodon ICG. (note: answer all possibilities)
DA UGA
QUESTION 1
OB.CGU
OC CGA
OD UGC
DE CGC
QUESTION 3
Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the RNA".
O True
O False

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
First base of RNA codon Provide the sequence of amino acids that would be translated from the following strand of RNA. Use the chart provided below: Second base of RNA codon U A UUU UCU UAU UGU Phenylalanine Tyrosine Cysteine UUC (Phe) UCC UAC (Tyr) UGC (Cys) C U Serine UUA UCA (Ser) UAA Stop UGA Stop Leucine UUG (Leu) UCG UAG Stop UGG Tryptophan (Trp) G CUU CCU CAU CGU Histidine CUC CCC CAC (His) CGC 0 Leucine Proline Arginine CUA (Leu) CCA (Pro) CAA CGA (Arg) Glutamine CUG CCG CAG (Gln) CGG AUU ACU AAU AGU Asparagine Serine AUC Isoleucine ACC AAC (Asn) AGC (Ser) A (lle) Threonine AUA ACA (Thr) AAA AGA Lysine Arginine AUG Met or start ACG AAG (Lys) AGG (Arg) GUU GCU GAU GGU Aspartic GUC GCC GAC acid (Asp) GGC G Valine Alanine Glycine GUA (Val) GCA (Ala) GAA GGA (Gly) Glutamic GUG GCG GAG acid (Glu) GGG AUGGGC CUAGGAUUUCCAACCUAG Edit View Insert Format Tools Table 12pt Paragraph BI U T² : Third base of RNA codon
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above)