1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Glutamic Acid-Glutamic Acid- CO

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…

A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and…

A: RNA or ribonucleic acid is a molecule which play a significant role in expression of genes via…

Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…

A: Ans- Tyrosine was replaced with cysteine.

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If…

A: The genetic codon present in the mRNA will be translated into polypeptide chain by ribosome during…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: Which of the following statements is false about the structure of TRNA? O Because of hydrogen bonds,…

A: RNA is ribonucleic acid which is single stranded .It is of three types :- A ) mRNA B ) tRNA C ) rRNA

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: . By inspecting Table 4.5, discuss how the genetic code has evolved to help minimize the impact of…

A: A genetic code is a set of three nucleotide bases that is used to translate information encoded in…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…

A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence

A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Q: An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA…

A: Codons are in the form of triplets , for example AUG that codes for methionine ( amino acid). Codons…

Q: Write the codons for the following amino acids. 1. Phe 2. Val

A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: A frameshift mutation in a gene is when nucleotide bases are added or removed in increments that are…

Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…

A: Most soluble in water.

Q: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA…

A: Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.