The following eukaryotic DNA is transcribed into RNA and the mRNA transcript is translated into protein. 1 GGC GAC GACA TATAAAGCGA 41 TATCCATGGA 81 AATAAAACGC 121 GTCGACTGC 5' UGGAC 3' 5' TGGAC 3' 3' UGGAC 3' 11 O 3' TGGAC 3' 51 CGCGCCATGG 21 91 CGACTGTAGA 61 Useful sequences: TATA box: TATAAA, Kozak sequence: A/GccAUGG, Poly-adenylation signal: AAUAAA What are the first bases in the mRNA transcript? TCACATAAGC GGTGC GAT GC 111 GTATCAGTCA TTCAGCGTAG TCTGATGC CA 31 CT GAT GAGCC 71 101

Q: pro-ser-cys

A: The given peptide is made up of three amino acids that are proline, serine, and cysteine. All of…

Q: How do we know that Intumane theX efromsscmesplay NOROLEIN sex determinationt

A: Sex determination in human being is done on the basis of XX/XY chromosomes.

Q: STR ⒸDigital Frog International A B

A: Introduction  The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: А C D

A: The instrument or electrical device that can be used for observing small objects like cells is…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: بار در انبار الدولة ر

A: The ECG or electrocardiogram is a test that is used to detect the heart rhythm and electrical…

Q: What

A: we have to add correct word in the above blank

Q: Name please_

A: 1) Metzenbaum-Nelson curved scissors 2) Doyen's curved scissors  3) Curved artery forceps

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: Diarrhea prefix meaning

A: We know that Medical terminology  Terminology includes a group of words related to subject area. It…

Q: name the feature (blue circle)

A: The skeletal system is one of the 11 major body organ systems that are concerned with various…

Q: Vessel identify tag 20?

A: The deoxygenated blood brought from various regions across the body is brought to the lungs for…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: what is the groin?

A: In human anatomy, the groin is the juctional area between the abdomen and the thigh on either side…

Q: O O C

A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…

Q: 7

A: The urinary system is responsible for the production, storage, and excretion of urine. Urine is…

Q: What is a usuai Y-incision?

A: Incisions are defined as the surgical cuts that are carefully made on the body of the person in…

Q: ABUSE AND NEGELCT

A: As frontline advocates, nurses help detect and address key concerns like abuse and neglect that have…

Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-

A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…

Q: I letters

A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: В

A: All the 3 diagrams/ structures given are containing theCOOH group and a C-H backbone that's the…

Q: 28 29 Mark Nielsen

A: Skeletal muscle is one of the major muscles in the body which is regulated by the somatic nervous…

Q: diathroses

A: The study of joint is termed as arthrology. A joint or articulation is a point of contact between…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: Can you do the first part

A:

Q: Answer- 0

A: We know that cellular respiration is the process in which breakdown of food will take place and it…

Q: Questions: 1. Select a discrete colony. Describe the appearance of the colony. 2. Describe the…

A: The study of bacterial cultures is an interesting aspect of microbiology. It includes the cautious…

Q: ware do baby come fron

A: The reproduction is the very important characteristics of living organisms that ultimately…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.