A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of learning how to synthesize stomach tissue in the lab. Subsequently, they determine the exact sequence of amino acids of the protein in its unfolded state, and create a functional mRNA template to translate Protein X in vitro. They manage to translate an exact copy of the polypeptide chain in the lab, but then realize that it takes several days for the protein to fold into its final tertiary structure. In vivo, they observe that several thousand copies of Protein X are folded from polypeptide chains every minute. What is NOT a plausible explanation for this difference in folding times?

Q: A synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be…

A: The key enzyme involved in transcription is RNA polymerase, which synthesises a complementary strand…

Q: B14. The last two amino acids added to a polypeptide are - Trp - Glu - (C terminus). The last two…

A: To determine the last two anticodons used in the translation of the given polypeptide sequence, we…

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: The steroid progesterone has an important role in the female reproductive system. Researchers…

A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…

Q: draw the structures of the first dipeptides made in bacterial protein synthesis reactions when the…

A: The origin sequence is of 100 to 200 base pairs where replication fork begins. Specific proteins…

Q: Ornithine is structurally similar to lysine except ornithine’s side chain is one methylene group…

A: Ornithine plays important role in urea cycle. Ornithine is structurally similar to lysine except…

Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?

A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…

Q: You are studying a human cancer cell line and you notice that you see the normal amount of RNA but…

A: INTRODUCTION Mutation Mutations are the sudden heritable changes in the genetic material occur due…

Q: The gene ABCD is 1500 bases long.  Answer the following questions:   What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: In eukaryotes, RNA polymerase II produces capped RNA during transcription. (i) Draw the chemical…

A: "DNA plays a crucial role in the process of protein synthesis. The information stored in DNA is used…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high…

A: In the 1950s, Christian Anfinsen performed a series of studies. He discovered that all the…

Q: Which of the following is the correct tRNA anticodon for the Methionine codon (5'-AUG-3'). Hint:…

A: t RNA is the transfer RNA. The main function of transfer RNA is to carry amino acid on its amino…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Splicing  The removal of introns (non coding part of gene) from pre mature RNA.

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: TRUE OR FALSE a) The structure of the purines and pyrimidines make them able to undergo keto-enol…

A: Purines and pyrimidines are nitrogen-containing aromatic compounds. They are the major components of…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: Consider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that…

A: Amino acids are the simplest units to form peptides and proteins. The amino acid sequences represent…

Q: 70

A: The conversion of information saved in the DNA to proteins is required. The central dogma describes…

Q: e nucleotide sequence of this anticodon loop under tant tRNA will, a) Recognize GCC as the codon for…

A: tRNA refers to transfer RNA. It helps in decoding an mRNA sequence into a protein. Three nucleotides…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?

A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…

Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…

A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: tRNA : It is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length, that…

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: The figure below shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A…

A: Step-2:  The peptidyl transferase is a part of large subunit of ribosome (23S rRNA). It function as…

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.