You are studying a human cancer cell line and you notice that you see the normal amount of RNA but the protein concentration is extremely low. When you investigate more closely you notice that the MRNA is properly processed and in the cytosol but you detect very little protein. When you sequence the mRNA you see no mutations. a) When you sequence the ribosomal RNA associated with the small subunit you notice two transition mutations. What function of the ribosome might be disrupted by these mutations? b) You also sequence the DNA encoding the large ribosomal subunit and notice one substitution mutation. What function of the ribosome might be disrupted by this mutation?

Q: The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to…

A: mRNA  The short chain of RNA molecule that is made by the process of transcription. And translated…

Q: The following image represents a gene model. Which part is (are) exon(s)? type your answer... Which…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: scientist isolates two specific mRNAs.  One codes for the enzyme fowlase, an enzyme that is involved…

A: Cell is the structural and functional unit of the organism.

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Proteins like channels embedded within the cell's plasma membrane and enzymes scattered in the…

A: Protein synthesis is a complex biological process that involves transcription of the gene into mRNA…

Q: If a viral host cell has a mutation that interferes with the addition of carbohydrates to proteins…

A: It is a multiple choice question.

Q: In diseases such as Creutzfeldt-Jakob disease (CJD), a normal prion protein becomes infectious and…

A: Creutzfeldt-Jakob Disease:  Creutzfeldt-Jakob disease (CJD) is a neurodegenerative disease that…

Q: Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to…

A: Answer) The correct option is a) Eukaryotic mRNA.   In eukaryotes, The genes contain some non-coding…

Q: You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the…

A: Charles Yanofsky and colleagues in 1964 discovered that nucleic acid sequences and the translated…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW  Why Phosphate bond is important in DNA or RNA…

A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…

A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Q: Match the following with what organelle (one per blank) it is designated to go (letter can be used…

A: According to the question, we have to make a match the following with what organelle. So, let us…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…

A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…

Q: Place the steps below in the correct order to accurately reflect the steps by which a secretory…

A: Protein synthesized by membrane bound ribosome translocate the ER (endoplasmic reticulum) membrane…

Q: Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an…

A: BRCA 1 or Breast cancer type 1 susceptibility protein is a protein that in humans is a tumor…

Q: This is a list of molecular changes that could happen during DNA replication, transcription, mRNA…

A: The mutation alters allele frequencies by constantly introducing new alleles, which can be…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.