30  A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?

Q: You isolate a peptide that has the sequence Met-Val-Arg-Gln-Leu-Tyr-Lys-Trp Predict whether the…

A: Amino acids are compounds containing Carbon, hydrogen, oxygen and nitrogen and serve as monomers…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: How many different sequence possibilities are there for a double-stranded RNA polymer that is 6…

A: At each base, one can have any of the four different bases (A,U,C or G). Therefore for the first…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to…

A: tRNA is a small, well-characterized RNA molecule which plays a key role in protein biosynthesis.…

Q: Which of the following is the correct tRNA anticodon for the Methionine codon (5'-AUG-3'). Hint:…

A: t RNA is the transfer RNA. The main function of transfer RNA is to carry amino acid on its amino…

Q: The amino acids in a normal polypeptide chain are proline, arginine, aspartic acid, lysine, and…

A: The DNA sequence of a gene is altered to generate a different result, which is known as a genetic…

Q: About 98% of the E. coli genome codes for proteins, yet mRNA, the template for protein synthesis,…

A: In order for a gene to be converted into a functional protein, it has to undergo two processes…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal…

A: Sequencing of proteins is done by treating Proteins with different enzymes that have specificity in…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: Transfer RNA (tRNA) molecules contain a sequence of three nucleotides known as the anticodon. It is…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: 2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino…

A: Translation is a 2 step process where nucleotide sequence transcribed from DNA present inside…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: 1. You order two primers from a company that synthesizes oligonucleotides. The primers have the…

A: Primers are short stretches of nucleotides that are used to initiate the synthesis of nucleic acids.…

Q: The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’…

A: Introduction: A bacterial protein termed restriction enzyme, also known as restriction endonuclease,…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given…

A: RNA strnad given = 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' (i) DNA strand from which this mRNA is…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.