Suppose an mRNA transcript with the following base sequence reaches a ribosome:5' AUGCGUUAUGGCUACUGA - 3'Give the primary structure of the protein that the ribosome will build, by writing the 3-letter codes of the amino acid residues in the usual order (N- toC-terminus).If there is more than one possible protein that will be produced, write the amino acid residue sequence for any of them. You will find some useful informationabout the genetic code and amino acids in the ALEKS Data resource.I Don't KnowSubmitO 2022 McGraw Hill LLC. All Rights Reserved. Terms of Use Privacy Center | AcceDELLF4F10F11F12PrtScrInsertDeletePgLF1F2F3F5F6F7F8F9"R%2#$4&Backspace

A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Answered: Suppose an mRNA transcript with the…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.
Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.
Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The template DNA strand will have the following sequence written in the conventional manner with no orientation indicators: The corresponding tRNA sequence written in the conventional manner with no orientation indicators will be: After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, the sequence of the resulting polypeptide is
In Figure 9-12, is the terminal amino acid emerging fromthe ribosome encoded by the 5′or 3′end of the mRNA?
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reaction
Pretend you are a ribosome that is going to translate the following mature mRNA sequence into a polypeptide chain. What are the first five amino acids encoded in this mature mRNA sequence?…
The diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'
First start with a pre-MRNA with four exons and three introns and diagram the splicing reactions leading to the four exons being spliced together (a) Second, show the following two alternative splicing diagrams that would produce (b) intron 2 retention, otherwise similar to part (a) (c) mutually exclusive exon (exon 1- either exon 2 or exon 3 -- exon 4) (d) exon 2 skipping, otherwise, similar to part (a). For part (d), explain how an SR protein could influence whether exon 2 is skipped. What would happen if SR binding to the exon 2 ESE was weak? Which MRNA isoform would be more abundant?
If the two ribosomal subunits did not come together during translation, and the small subunit attempted to facilitate translation alone, why would translation not occur? Explain with reference to mRNA and tRNA.
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS