Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands. (SLO1) 5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’ 3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: Choose the correct protein sequence that would result from the following DNA template sequence using…

A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write…

A: The coding strand is complementary to the template strand.  The template strand is the DNA sequence…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: A research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived…

A: cDNA stands for complementary DNA (deoxyribonucleic acid). An intron is a particular sequence of…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.