Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
A research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5′–ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCA– GCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATC– CCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATA– CAGTATAATCATATA–3′ Genomic DNA (contains one intron):
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAG CGGCCAGACTATCACCCAACTCGGCCCACCCCCCAGGTTTA– CACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCA– AAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAG– GTTACCTACTAGTATATCCCATATACTAGCATATATTTTAC– CCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3′
Indicate where the intron is located. Does the intron contain the normal consensus sequences for splicing, based on those shown? Underline the splice site sequences, and indicate whether or not they fit with the consensus sequences.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
