Homework Help is Here – Start Your Trial Now!
Science
Biology
Label the following diagram

Label the following diagram

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
Label the following diagram
Name: Date: Class: Messenger RNA Modification Nucleus AUGACGGAUCAGCCGCAAGCGGAAUUGGCGACAUAA EYMYYT 2 AUGACGGAUCAGCCGCA AGCGGA AUUGGCGACAUAA 5' 4 AUGACGGAUCAGCCGCAAUUGGCGACAUAA AAAAAAAA 5'UWAA 3' AUGACGGAUCAGCCGCAAUUGGO JAAAAAAAAAA 3' 8 GGUA 9 Cytoplasm Label the diagram as you read the following passage. After transcription, the messenger RNA needs to be edited and modified before it leaves the nucleus. The first segment of RNA that is produced through transcription is called the pre-mRNA. This contains sections of the RNA that are essential to the "message" being sent to the ribosome to build a protein and these important sections are called exons. It also contains sections of RNA that are not needed and these sections are called introns. The process of cutting out introns from the messenger RNAS is called splicing. A bunch of enzymes in a complex called the spliceosome cut the introns out. Outside the nucleus in the cytoplasm, there are ribonuclease enzymes that float around and destroy "naked" RNA strands. These ribonucleases are important because a lot of "naked" RNA that happens to be in the cytoplasm are from viruses that have invaded the cell! Ribonucleases destroy viral RNA and other foreign RNA that could harm the cell. The cell needs to have some way to mark its own RNA so that ribonucleases won't destroy them. The cell does this two ways. The cell adds a modified guanine base on the 5' end called the 5' methyl G cap. The cell also adds a poly-A tail on the 3' end. The poly A tail is made up of lots of adenine ribonucleotides and it provides a sort of cushion. Once the pre-mRNA has its introns cut out and a poly A tail and methyl G cap added, it is properly "dressed" and is called the mature mRNA. It can be transported out of the nuclear pores into the cytoplasm. The ribonuclease enzyme that bumps into the mature mRNA with a tail may start destroying and dismantling the tail, but it takes a long time to start destroying the important part of the messenger RNA, the actual message that tells the ribosome how to build a protein (C) 2015 Bethany Lau.
Transcribed Image Text:Name: Date: Class: Messenger RNA Modification Nucleus AUGACGGAUCAGCCGCAAGCGGAAUUGGCGACAUAA EYMYYT 2 AUGACGGAUCAGCCGCA AGCGGA AUUGGCGACAUAA 5' 4 AUGACGGAUCAGCCGCAAUUGGCGACAUAA AAAAAAAA 5'UWAA 3' AUGACGGAUCAGCCGCAAUUGGO JAAAAAAAAAA 3' 8 GGUA 9 Cytoplasm Label the diagram as you read the following passage. After transcription, the messenger RNA needs to be edited and modified before it leaves the nucleus. The first segment of RNA that is produced through transcription is called the pre-mRNA. This contains sections of the RNA that are essential to the "message" being sent to the ribosome to build a protein and these important sections are called exons. It also contains sections of RNA that are not needed and these sections are called introns. The process of cutting out introns from the messenger RNAS is called splicing. A bunch of enzymes in a complex called the spliceosome cut the introns out. Outside the nucleus in the cytoplasm, there are ribonuclease enzymes that float around and destroy "naked" RNA strands. These ribonucleases are important because a lot of "naked" RNA that happens to be in the cytoplasm are from viruses that have invaded the cell! Ribonucleases destroy viral RNA and other foreign RNA that could harm the cell. The cell needs to have some way to mark its own RNA so that ribonucleases won't destroy them. The cell does this two ways. The cell adds a modified guanine base on the 5' end called the 5' methyl G cap. The cell also adds a poly-A tail on the 3' end. The poly A tail is made up of lots of adenine ribonucleotides and it provides a sort of cushion. Once the pre-mRNA has its introns cut out and a poly A tail and methyl G cap added, it is properly "dressed" and is called the mature mRNA. It can be transported out of the nuclear pores into the cytoplasm. The ribonuclease enzyme that bumps into the mature mRNA with a tail may start destroying and dismantling the tail, but it takes a long time to start destroying the important part of the messenger RNA, the actual message that tells the ribosome how to build a protein (C) 2015 Bethany Lau.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps with 1 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Dissection
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS