ΝΑ ho DDI Build the complementary strand of Messenger RNA to t single DNA strand that has unzipped during transcription.. Teamwork Toolrox 8 (12) DRAGO insert PISC

Q: Each two nucleotide combination is called a codon. True False

A: Nucleotide: A nucleotide is the basic building block of nucleic acids such as DNA and RNA. It…

Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…

Q: Not all the bases of an mRNA message are used for coding. Which of the following is a possible…

A: mRNA  is messenger RNA that is translated by the ribosomes and generate a protein product. It has…

Q: If you got the previous question correct, lets try a question slightly harder but one along the…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to…

A: The transcription is the process that involves production of RNA from the DNA template. In case of…

Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…

A: The peptide sequence and the mutations occur in codons is given below

Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…

A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…

Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…

A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…

Q: What two types of molecules are involved when a codon pairs with its anticodon?

A: Ans. Genetic code is a term used to identify the four bases of DNA, A, C, G, and TS, in a way that…

Q: Font Paragraph Styles Editing Voice Editor Reuse Files ...1. .. 2. . . 3 -. . .. 4- . ... 5-... 6..…

A: Transcription: its the process in which the DNA segment is converted to the RNA(mRNA). In this…

Q: During splicing, what molecular component of the spliceosome catalyzes the cutting out of the…

A: Splicing: Splicing is the process in which the introns and the noncoding part of the genes are…

Q: Explain how RNA splicing and alternative splicing are relevant to your life and how is it useful?

A: transcription is the process by which dna makes rna copies , mainly mRNA molecules . this is also…

Q: AUG is the most common start codon found in translated genes. Which of the following is true of…

A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…

Q: I need a key for my practice exam thank you

A: 1.Answer-

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: molecular biology technique Gene cloning & identification  that have been used to study the  protein…

A: Molecular techniques are laboratory methods that manipulate and analyze DNA, RNA and proteins at the…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: P-bodies are... Sites of protein phosphorylation. Loosely organized protein aggregates involved in…

A: Processing bodies (P-bodies) are cytoplasmic ribonucleoprotein (RNP) granules primarily composed of…

Q: You have identified a mutation. In the normal organism the DNA TEMPLATE strand is 5'AGT3' in the…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…

A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…

Q: What is the name for the step where RNA is created from a strip of DNA? Transcription Translation…

A: Introduction:- Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are most important molecules…

Q: What is translation?  Synthesizing a protein from a strand of mRNA   Coping a new strand of DNA…

A: Introduction: The type of nucleic acid that is present in the nucleus of the cell is…

Q: Post-translational modifications of proteins may include which of the following processes? Hint:…

A: Please follow steps 2 & 3 for a detailed explanation of both questions.

Q: 8. Which statement/s about RNA is/are true? (Select all that apply.) * RNA is made through the…

A: 8.RNA stands for ribonucleic acid.It act as a genetic material in a viruses.It also play essential…

Q: Second base of codon C A UUU Phenylalanine UCU UAU UGU Cysteine U Tyrosine tyr y U UUC phe F UCC…

A: The process of protein synthesis is called translation. messenger RNA, transfer RNA and ribosomes…

Q: What is the most likely reason a southern blot may not be able to detect KSS in the clinic? O A…

A: Kearns-Sayre syndrome (KSS) is a mitochondrial myopathy with a typical onset before 20 years of age…

Q: What would most likely occur to nuclear import if the GTPase Activating Protein of RAN was inhibited…

A: Nuclear Import Protein contains a short signal sequence of an amino acid called Nuclear Localization…

Q: 4) RNAI is the name used to describe a system that cells use to shut down the translation of…

A: ANSWER;- RNAi is mainly of two types: small interfering RNA(siRNA)- which are made artificially or…

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…

Q: can i get help with this??

A: Transcription is the process by which the mRNA is synthesized from a DNA. During this process, one…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.