Q: 5) Match the tissue name on the left with the description that best matches the structure of cells m...
A: According to our guideline i will answer only first one but i gave you both of the answers in step 2...
Q: phylogenetic tree for the ERF1 gene.
A: A phylogenetic tree, also known as a phylogeny, is a diagram that depicts the lines of evolutionary ...
Q: 5 1. 4 6. A 3 1 9 7 8 1. What Viral cycle is being described by A? What about B? 2. For each numbere...
A:
Q: Wolf biologists started estimating the number of wolves in 2000 at 21 wolves in GTNP population. In ...
A: Given data: Number of wolves in 2000= 21 Number of wolves in 2010= 105 Doubling time= ? Tripling t...
Q: Which one of these cell types lacks a cell nucleus and therefore have no DNA? A) Glia cells B) Red b...
A: Glia cells are basically located in the peripheral and central nervous system. These cells are also ...
Q: A seed of a plant you are examining has one "seed leaf", a structure that nourishes the growing plan...
A: One " seed leaf" ( or cotyledon ) is the characterstics of monocots. Cotyledons are the first leaves...
Q: For each non-human animal, take a highlighter and mark any amino acids that are different than the h...
A: Cytochrome C (Cytochrome complex) is a mitochondrial protein which us loosely located in the interme...
Q: he patient, a 16 year old female was well until 2 days prior to admission when she had a fever to 39...
A: Bacterial Infections need to be taken care of in a serious manner or else they tend to infest the or...
Q: Describe the two phenomena that give rise to the diversity of adhesion molecules such as cadherins. ...
A: Introduction:- Animal cells use integrins as their primary receptors for binding to the extracellula...
Q: Practice: Cross a wild female with a male that has whi rom the exercise that both these traits are x...
A: Alleles- An Individuals receive two variant of each gene from each parent are known as alleles. Thes...
Q: Stellvester Ajero is a farmer who raises deer in his ranch. He has 100 female deer age 3–15 months. ...
A: As given, the deer require 22 MJ of metabolizable energy per day during the spring months.
Q: 3) When she was a young child, Mélanie had a favourite swing hanging from the lower branch of a tree...
A: Brief Description of plants growth in heights.
Q: What can happen to tissues when tight junctions do not function properly?
A: Introduction:- Tight junctions, sometimes called Zonula Occludens, are cell-cell adhesion complexes ...
Q: In northern latitudes, a variety of birds and mammals createstorage depots of food, termed caches, i...
A: Physiology of development The study of functional qualities at various phases of an individual anima...
Q: Both benign and malignant tumors can arise from most types of epithelial cells. Why is this so? Expl...
A: Benign tumors and malignant tumors are the two type of tumors which arise in cancer. Whereas, Benign...
Q: Question 47 (1 point) Which of the following options describes the speed at which force may be produ...
A: Type 1 muscles fibers are present for long duration of contractile activities.and found in the endur...
Q: taxonomic hierarchy of the following organisms: 1. Gumamela 2. Jelly fish 3. Oregano 4. Hummingb...
A: The taxonomic hierarchy of Gumamela is: Domain Eukaryote Kingdom Plantae Phylum Tracheophyta ...
Q: Explain why angiosperm wood is considered to be evolutionary more advanced than the gymnosperms wood...
A: Angiosperms(flowering plants) are those plants that have their seeds protected inside the flower or ...
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a resu...
Q: Virology:To make an mRNA vaccine ,you need 1) a template, 2)an RNA polymerase,3) a mechanism for add...
A: Vaccinations and Immunizations started in the 18th century, with the Smallpox Vaccination, created b...
Q: Which of the following is/are correct? a. Stained preparations of bacterial cells reveal much more d...
A: Gram staining is used to identify bacteria. It is used to find bacterial infection in the cell.
Q: What nucleic acid makes up this viral genome?
A: The virus life cycle divided into six steps that isattachment, penetration, uncoating, gene expressi...
Q: Cladogram Example poutgroup O Taxon 1 root branch B o Taxon 2 Ingroup O = internal node (ancestor) O...
A: Cladograms are diagrams that show the links between several taxonomic groups, or "clades." Cladogram...
Q: Colorblindness is inherited as an X-linked recessive trait while pattern baldness is controlled by a...
A: Colourblindness is X linked recessive condition in which recessive allele h is present on X chromoso...
Q: 1. Enumerate the similarities among the lophophorates phyla. 2. Tabulate the distinguishing characte...
A: 1. Phyla is a group of related living things (as animals or plants) that ranks above the class and ...
Q: T=dominant tall (genotype tall, phenotype tall) Tt=mixed hybrid (genotype hybrid, phenotype tall)...
A: Heterozygous: When a diploid organism's cells contain two different alleles of a gene, it is said to...
Q: Explain why mitosis I is considered a reduction division and describe why that is important in sexua...
A: Mitosis is basically a phenomenon of cell division, where in chromosomes get replicated and separate...
Q: Where are stem cells located in plants?
A: Introduction :- Stem cells are cells that have the ability to differentiate into a variety of variou...
Q: How do we find out whether a vertebrate such as a cat or asalamander has a central pattern generator...
A: Humans have a tendency to possess a central pattern generator. This is used for the purpose of locom...
Q: If you are asked to synthesize a cell using only five parts, what parts will you include to ensure t...
A: The cells are the smallest structure and functional unit of the organism that perform specific funct...
Q: Use the morphological traits shown in Table A to construct a phylogenetic tree for plants (any style...
A: A phylogenetic tree is a diagrammatic representation which evaluates how the taxons are closely rela...
Q: Question 25 Which of the following is true re: oxygen saturation curves? Hemoglobin saturation curve...
A: Hemoglobin is a protein that binds to oxygen and carries it.
Q: What are small ways that you think would promote safekeeping in our biodiversity? What do you think ...
A: Biodiversity is the variety of living organisms such as different species of micro organisms, plants...
Q: Among vertebrates, acoustico-lateralis hair cells are used todetect water currents in lateral line o...
A: Receptors are of different types based on their ability to respond to different stimuli.
Q: Which among these classes of bacteria includes the purple sulfur bacteria? Alpharoteobacteria Gammap...
A: Introduction :- Purple sulfur bacteria (PSB) are photosynthetic bacteria that use hydrogen sulfide i...
Q: Why are only inherited variations important in the evolutionary process? Explain your answer.
A: Evolution is a process that causes changes in a population's genetic material through time. Evolutio...
Q: Туре of transport protein State of Energy Important proteins Origin Destination required involved in...
A:
Q: What two ions are responsible for the stacking of the proteins in the stacking gel? Which is the zwi...
A: SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) which is a discontinuous electr...
Q: Make a simplified schematic representation of the connective tissue cell lineage derived from hemato...
A: Stem cells are employed in regenerative medicine, which uses drugs to induce adult stem cells in the...
Q: Description of Eragrotis obtusa
A: Here we describe the plant Eragrotis obtusa.
Q: This is a series of skulls and front leg fossils of organisms believed to be ancestors of the modern...
A: 2.The skull lacked the large, flexible muzzle of the modern horse, and the size and shape of the cra...
Q: Please discuss the common causes of kidney infections.
A: The infections caused in kidneys are called as kidney infections they are called as pyelonephritis. ...
Q: Which of the following are antibiotics? X-gal and IPTG haemolysin Escherichia coli pBluescript ...
A: Antibiotics are specific molecules that are released by some bacteria. Actually it is used as the de...
Q: METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS DIAGNOSIS Phenylketonuria Gout Ketosis Fatty l...
A: Alkaptonuria and phenylketonuria are called inborn errors of metabolism. The disorders are usually c...
Q: Which of the following illustrates the regulative nature of early mouse development? (a) the mouse e...
A: The mouse has been used as a model organism to study the development of mammals.
Q: How do changes in molecular connections between the ECM and the cytoskeleton give rise to Duchenne m...
A: Muscular dystrophy can be defined as a group of diseases that is responsible for the weakness and lo...
Q: Disease/Illness if there is a Importance malfunction of the organs Muscular System 1. Skeletal Muscl...
A: Muscle is one of the types of soft tissue in which the cells contain protein filaments of actin and ...
Q: Classify each question based on the ecological level on which it focuses. How does the rate of disea...
A: A.The relationship between population growth, size, and infection is dependent on the changes in con...
Q: 3. Where do you think the carbon atoms in the glucose molecule originally came from? Choose all that...
A: Carbon atoms moves into biosphere and in food webs by this process.
Q: Evolution is based on which of the following concepts? (a) organisms share a common origin (b) over ...
A: Heritable change in the characteristics of biological populations over successive generations is kno...
Can you please help me with the following; thanks!
An experiment that shows that there is a targeting system for a nuclear encoded protein that ultimately finds its way to a specific organelle.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGBugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018. Give an example of a technique that can be used to measure the affinity of the antibody for Factor 801A? Explain how it works David adds that an…BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018. The VP of Marketing, Andrew Flynn, asks about the current treatments for ovarian cancer. David explains that most ovarian cancers spread through…
- BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018 Propose a protocol (~100 words) to study the efficacy of the antibody in this mouse model.BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018 Propose a PK protocol (~100 words) to study the distribution of the antibody to Factor 801A after IP injection in mice. …BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018. The VP of Marketing, Andrew Flynn, asks about the current treatments for ovarian cancer. David explains that most ovarian cancers spread through…
- You are in charge of a new gene therapy clinic. Two cases have been referred to you for review and possible therapy. Case 1. A mutation in the promoter of a proto-oncogene causes the gene to make too much of its normal product, a receptor protein that promotes cell division. The uncontrolled cell division has caused cancer. Case 2. A mutation in an exon of a tumor-suppressor gene makes this gene nonfunctional. The product of this gene normally suppresses cell division. The mutant gene cannot suppress cell division, and this has led to cancer. What treatment options can you suggest for each case?Please answer the following questions: 1. What is the role of MinC, MinD, and MinE in bacterial cell division? a. What would happen if MinC was deleted from the cell? (Be as specific as you can) b. What would happen if MinD was deleted from the cell? (Be as specific as you can) c. What would happen if MinE was deleted from the cell? (Be as specific as you can) 2. What would happen if SulA was deleted from a bacterial cell? 3. If a culture had 150 cells to begin with, how many cells would be present after 6 generations? 4. If a culture had 4 cells to begin with and has a generation time of 60 minutes, how long would it take to get 1,048,576 cells? (Although we didn't learn this explicitly, between you, google, and your long lost math skills, I know you can do it). 5. Describe the four phases of bacterial cell division. a. Where would horizontal gene transfer occur? b. Where would sporogenesis occur? c. If antibiotics generally target cells which are growing and dividing as fast as they…What is the rationale for synthesizing and rapidly degrading p53 protein in the cell? please give me new answer
- how do i expand this into 1000 words The methodology employed to identify differentially expressed genes (DEGs) in breast cancer using RNA-Seq data involves several systematic steps integrating data retrieval, analysis, normalization, DEG identification, and functional annotation. Initially, raw RNA-Seq data is retrieved from the NCBI GEO database, specifically from dataset GSE216238 (Nakshatri, 2023), which encompasses samples from both breast cancer and normal tissue. Subsequently, the raw data was imported into Excel for initial analysis, leveraging its widespread availability and user-friendly interface. Gene expression data for breast cancer analysis was obtained from the Gene Expression Omnibus (GEO) database. The GEO homepage (https://www.ncbi.nlm.nih.gov/geo/) was accessed, and the "Query & Browse" tab was selected. Advanced Search: Under "Search GEO DataSets," an advanced search was conducted (https://www.ncbi.nlm.nih.gov/gds/advanced). Keywords "breast" and "cancer" were…Emtricitabine (2',3'-dideoxy-5-fluoro-3'-thiacytidine, abbreviated as FTC) is a nucleoside analog that is used to treat HIV. It works by reversibly binding to HIV reverse transcriptase (HIV RT) and by doing so, inhibits the virus from replicating itself. In an experiment, FTC and purified HIV RT are mixed at low concentrations and allowed to reach equilibrium. The concentrations measured are [FTC] = 10 nM, [HIV RT] = 37.5 nM, and [HIV RT-FTC] = 2.5 µM, for the equilibrium FTC + HIV RT= HIV RT-FTC. What is the Kd in nM?For each of the following situations, provide a plausible explanation for how it could lead to unrestricted cell division.(a) Colon cancer cells often contain mutations in the gene encoding the prostaglandin E2 receptor. PGE2 is a growth factor required for the division of cells in the gastrointestinal tract.(b) Kaposi sarcoma, a common tumor in people with untreated AIDS, is caused by a virus carrying a gene for a protein similar to the chemokine receptors CXCR1 and CXCR2. Chemokines are cell-specific growth factors.(c) Adenovirus, a tumor virus, carries a gene for the protein E1A, which binds to the retinoblastoma protein, pRb. (d) An important feature of many oncogenes and tumor suppressor genes is their celltype specificity. For example, mutations in the PGE2 receptor are not typically found in lung tumors. Explain this observation. (Note that PGE2 acts through a GPCR in the plasma membrane.)