What is translation?  Synthesizing a protein from a strand of mRNA   Coping a new strand of DNA from an existing strand   synthesizing a protein from a strand of DNA   Copying a strand of RNA from a strand of DNA

Q: What occurs during transcription? Where in the cell does this take place?

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: What is the direction of RNA synthesis? Is it the same as DNA replication?  How does RNA…

A: Asked : Direction of RNA synthesis,DNA replication and RNA transcription end process

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: This is always the first step in the transcription process: O The two DNA strands are partly…

A: Transcription refers to the production of RNA from DNA. From the gene sequence of DNA, a…

Q: The MutH protein nicks the newly synthesized strand(Figure 16-23). How does it “know” which strand…

A: DNA mismatch repair (MMR) is a highly conserved biological pathway that plays a key role in…

Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…

A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens…

A: The Central Dogma of life involves three steps: DNA ==> DNA ==> RNA ==> Proteins The…

Q: Which process is the result of the post transcriptional modification of mRNA?

A: The above given statement is about post transcriptional modification.

Q: What are the enzymes involved in eukaryotic translation? topic is about: DNA Replication and…

A: Eukaryotic translation Ribosomes normally exists as the seperate subunits that are composed of the…

Q: What is the difference between transcription and translation? Transcription is the conversion from…

A: The genetic material is stored in the DNA of the nucleus of the cell.

Q: Which of the following eukaryotic MRNA transcripts would NOT be able to be translated? Select ALL…

A: Translation  It is defined as the process of formation of proteins by the ribosomes present in the…

Q: What serves as the template for making new MRNA?

A: In transcription process a template strand  is used to make a new RNA.

Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…

A: Messenger RNA  is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.

Q: In Figure 14-9, how are the positions of codonsdetermined?

A: Ans: Codon: The set of trinucleotide sequence of DNA or RNA is referred to as codon.

Q: RNAi is produced when                Question 26 options:     a single-stranded DNA shares the…

A: RNA interference (also called “RNA-mediated interference”) is a mecha­nism for RNA-guided regulation…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: During

A: Ans) During transcription, the coding strand is the same sequence as the newly synthesized mRNA…

Q: cleotides                nucleus                      adenine                      cytosine…

A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…

Q: Which of the following creates peptide bonds?

A: Peptide bonds are covalent bonds and is responsible for linking amino acids and forming polypeptide…

Q: Which nucleic acid has a double helix structure?     tRNA     mRNA     rRNA     DNA

A: Nucleic acids that are present in the environment can be of two different types based on the type of…

Q: rovide SIGNIFICANT differences between prokaryotic and eukaryotic transcription and translation.…

A: Both transcription and translation is the method by which the genes express themselves this is also…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: Why is the position of the first AUG after the ribosome-binding site critical?

A: Introduction  The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: which of the following causes transcription to end? RNA polymerase reaches the terminator RNA…

A: Many processes occur within the cell for its normal functioning. They include replication,…

Q: The enzyme that separates the two strands of a DNA molecule during replication is:   DNA ligase

A: 1. The enzyme that separates the two strands of a DNA molecule during replication is helicase. The…

Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…

A: Expression of eukaryotic gene in prokaryotic organisms like bacteria convey several challenges. The…

Q: How does the nucleotide sequence of the (+) DNA strand differ from that of the RNA transcript?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…

A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: The MRNA copy of the gene goes from the nucleus to the cytoplasm %3D The ribosome reads the…

A: Genes are the basis of genetic inheritance and they store genetic information passed on from the…

Q: What do you call the process of making chains of polypeptides out from RNA strand? Group of answer…

A: Nucleic acids are defined as the type of natural chemical compounds that play a major role in…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: In which direction does RNA polymerase elongate a strand of RNA? O 3' to 5' 5' to 3' Both 5' to 3'…

A: During elongation , RNA polymerase elongate a strand of RNA in 5' to 3' direction. RNA polymerase…

Q: RNA polymerase will attach with what sequence(s) and begin to make RNA? Anticodon Promotor stop…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.