Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a poly-A tail removal of exons

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5'-GGCCCUUUUACCCGGUUUU-3' 5'-GCAUCUUACUGAUGCUUUU-3' a stem-loop hairpin structure followed by a sequence of uracil residues in the RNA a palindromic region followed by a sequence of adenine residues in the RNA a sequence of uracil-adenine RNA-DNA base pairs

Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule? polyadenylation at the 3’ end 7-methyl-guanosine capping at the 5’ end excision of introns formation of quadruple-stranded DNA splicing of exons

MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.

MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.

Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot bind the ribosome? Group of answer choices splicing together of exons removal of introns 3′ polyadenylated tail 7-methylguanosine cap on the 5′ end RNA editing

A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.

Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap Addition of the 3’ poly A tail Splicing to remove exons and connect the retained introns Splicing to remove introns and connect the retained exons

None

The 3' poly-A tail Ⓒtransports degrades protects the pre-mRNA molecule.