Answered: Which is NOT a modification made to…

Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a poly-A tail removal of exons

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 12SQ

See similar textbooks

Related questions

Q: 6. You were asked by your laboratory instructor to prepare the following: 12 plates (use maximum…

A: The nutrient media contains essential nutrients to support the growth of microorganisms. Different…

Q: Question 2 1 pts The nundber and size of organelles in a cell correlates with that cell's function.…

A: Microtubule along with intermediate fillament and microfillament form cell cytoskeleton.…

Q: . .is the arrival of pollen on a receptive stigma. ... .

A: A flower is the reproductive part of an angiosperm plant's modified thick shoot. The transfer of…

Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…

A: Passive tissue is those that undergo stretching when they are not even stimulated and hence…

Q: Genetic linkage leads to the production of a significantly smaller than expected number of gametes…

A: Genes that are close enough together on a chromosome "stay together," and the variants (alleles) of…

Q: How is the final rate of transcriptionof a gene specified by the hundreds ofproteins that assemble…

A: DNA is referred to as a genetic material that is present in the living organism from a single…

Q: Stretching a skeletal muscle can depolarize sensory afferents that project into the spinal cord and…

A: Muscles Muscles are the soft tissue with ability to contract hence help in movement of body parts.

Q: What is the difference between genotype and phenotype? 2. A black guinea pig is mated to a white…

A: Alleles are the alternative form of a gene that are located on the same locus of homologous…

Q: salient features of guidelines on the disposition of confiscated wildlife species in the Philippines

A: Wildlife species are the animals that are undomesticated and live in an area where they arrive…

Q: Since different species of penguins may occupy the same habitat, explain why they may continue to…

A: Introduction Species include the members who are similar in morphology, and physiology and can…

Q: Why do you think most Americans do not take in enough calcium and/pr vitamin D in their diet? Should…

A: INTRODUCTION Vitamins and minerals are considered essential nutrients because they play many roles…

Q: Describe how thermodynamics and metabolism are related.

A: According to first law of thermodynamics energy can neither be created nor destroyed. Though it can…

Q: What are the current concerns with the rate of global meat consumption

A: Consumption of meat and meat products means an important source of nutrients proteins, iron and…

Q: Pathogens have a variety of traits that interact with a host and enable the pathogen to enter a…

A: A pathogen is an organism that is capable of causing disease in an organism. It is also known as an…

Q: Which are phagocytes in liver ? (A) Kupffer cells (B) Aciner cells (C) Diter cells (D) Hensen's…

A: Introduction - Neutrophils, macrophages, and dendritic cells (DCs) are phagocytes with the ability…

Q: On a local scale, why are sowbugs commonly found in some places but not others?

A: Sowbugs and their occurrence in limited environment :-

Q: Which of the following statements best describes the reason for the changing levels of PBDES in cor-…

A: PBDEs It is a fire retardant chemical that protects the object from catching fire. It is mainly use…

Q: The current state-of-the-art in forensic DNA profiling involves the PCR-amplification and analysis…

A: PCR is a process in which millions of copies of a specific sequence of DNA can be made in a matter…

Q: What is the full regulatory pathway of glycogen synthase and glycogen phosphorylase by insulin and…

A: Insulin is a protein hormone which is secreted by the beta cells of the islets of Langerhans in…

Q: Leech obtains continuous blood flow from its victim by pouring in it-

A: Leeches Leeches are triploblastic coelomates belonging to the phylum Annelida. Their bodies are…

Q: How many external membranes are present in a land plant chloroplast?

A: Chloroplast membranes consist of about 45% protein and 55% lipid. It is an organelle mainly…

Q: ORIGIN 1 acacttgctt ctgacacaac cgtgttcact agcaactaca caaacagaca ccatgctgac 61 tgctgaggag aaggctgccg…

A: The gene contains information to code for specific proteins in the form of the nucleotide sequence.…

Q: Question 88 How is a child with Type I diabetes similar to a child who is starving? Mark all that…

Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…

A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…

Q: sabuoraud slope culture contains a black mould. describe a diagnostic method you can use to identify…

A: Answer :: The Donas do Sabor Festival, a delightful tour of Salvador's kitchens run by women, has…

Q: ABCD Crime Scene DNA Fingerprint 11. What can you conclude about sample A's involvement in the crime…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: As climate change becomes a growing problem, studies are conducted to under the im- pacts on…

A: Climate change impact on tawny owls in Finland :-

Q: answer 1,2,3,4,5,6,7 and 8. 1. Diphyllobothrium latum 2. Taenia saginata 3. Taenia solium 4.…

A: Answered 1234

Q: A 43-year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…

A: Chronic Myeloid Leukemia is a blood cancer associated with BCR ABL translocation resulting in…

Q: List some differences between eudicots and monocots

A: Introduction :- The term eudicots, also known as tricolpates, refers to real dicots, which are…

Q: Select the correct options in the following and explain your choices. if [s] is much smaller than…

A: Introduction :- Enzymes are proteins that enable our bodies' metabolism, or chemical reactions, go…

Q: When chlorophyll is burnt which element is obtained ? (A) Ca (B) Na (C) Mg (D) Mn

A: Introduction :- Because of the presence of sunshine, chlorophyll is commonly described as being…

Q: How does the evolution of endodermis, lignified cell walls, sclerenchyma, vascular tissues, true…

A: Vascular plants are those plants it causes vascular tissues for the transfer of substances. Vascular…

Q: In the Chesapeake Bay estuary, the blue crab is an omnivore that eats eelgrass and other primary…

A: Introduction Food Web:- It is the interconnected food network between the organisms that are not…

Q: 5. How might exposure to a more acidic pH affect the growth, development and reproduction of sea…

A: Sea urchins come under the category of keystone species, indicating their abundance has a direct…

Q: How is it possible for some molecules to be atequilibrium across a biological membrane and yet not…

A: Introduction :- Biological membranes are made up of two sheets of lipid molecules (known as a…

Q: A 32-year-old woman who are suffering from thyrotoxicosis a biopsy of the thyroid gland has shown…

A: Introduction :- Hassall's corpuscles are composed of a structureless eosinophilic mass surrounded by…

Q: Why is glucose provided by glycogenolysis in the liver but not in skeletal muscle?

A: Through glycogenolysis process, glycogen broken down into glucose and provide energy. Muscle…

Q: After reading the paragraph below, answer the questions that follow. You're the manager of a factory…

A: The activity of the enzymes is subject to many conditions and situations. Factors like temperature…

Q: Question 29 Gestalt theorists were interested in how we determine which part of the environment was…

A: Answer :: Gestalt psychology Gestalt Principles of Perceptual Organization Definition Gestalt…

Q: Name of organisı Features used to ID: d.

A: The given diagram shown is the diagram of the filamentous green algae that lives in the fresh water…

Q: Match the viruses with the diseases that they cause: Human Immunodeficiency virus Herpes zoster H1N1…

A: Viruses are the connecting link between the living and the non living. These have some properties of…

Q: Why do some biologists think that the apicomplexans descended from dinoflagellates?

A: The finding of a nonphotosynthetic plastid in malaria and other apicomplexan pathogens has prompted…

Q: The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C)…

A: Ascaris is commonly known as roundworm. It belongs to phylum nematoda.

Q: he arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…

A: When the pressure inside the arteries is less than the pressure outside the arteries (due to…

Q: Why is Cyanotic heart disease important to know ?

A: Introduction The heart is a an organ that circulates blood throughout your body. It is your…

Q: Press the hotspot that indicates a human activity that adds carbon dioxide to the atmosphere. CARBON…

A: Human activity that results in carbon dioxide emission is :-

Q: a. you have been provided with a skin scrappping. how would you work on the specimen to be able to…

A: Fungi: fungus, plural fungi, any of the approximately 144,000 known species of fungi, which includes…

Q: similar clines in allele frequencies on different continents are evidence for

A: Adaptive evolution refers to evolutionary changes in an organism that makes it more suited for its…

Q: Where do optometry work? eg private/small business operators; large health service systems eg…

A: Introduction Optometry:- It is a healthcare profession which involves examining the eyes and related…

Question

Help please (36)

Which is NOT a modification made to pre-MRNA?
addition of a 5' cap
removal of introns
addition of a poly-A tail
removal of exons

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding protein sequence
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5'-GGCCCUUUUACCCGGUUUU-3' 5'-GCAUCUUACUGAUGCUUUU-3' a stem-loop hairpin structure followed by a sequence of uracil residues in the RNA a palindromic region followed by a sequence of adenine residues in the RNA a sequence of uracil-adenine RNA-DNA base pairs
Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule? polyadenylation at the 3’ end 7-methyl-guanosine capping at the 5’ end excision of introns formation of quadruple-stranded DNA splicing of exons
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot bind the ribosome? Group of answer choices splicing together of exons removal of introns 3′ polyadenylated tail 7-methylguanosine cap on the 5′ end RNA editing
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG
Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap Addition of the 3’ poly A tail Splicing to remove exons and connect the retained introns Splicing to remove introns and connect the retained exons