Which of the following statements is true for miRNA but not siRNA? Formed from an RNA transcript that folds into a hairpin. Single stranded RNA about 21 nucleotides. Processed from longer piece of RNA. Can be used to inhibit translation of mRNA.
Q: fractional occupancy
A: The fractional occupancy quantifies the fraction of total protein binding spots taken by ligands at…
Q: In mixed inhibition as shown below, please draw a lineweaver-burk plot when Kl is greater than KI'.…
A: Michalis Menten equation for given reactionE + S ESE+PVo - Initial velocity or initial reaction…
Q: 10. Experimental Determination of AG" for ATP Hydrolysis: A direct measurement of the standard…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: 애 애
A: Amino acids are the building blocks of protein. They are connected by peptide bonds. Each protein…
Q: Draw a phosphorylated tyrosine molecule at physiological pH. Assume that the phosphate group is…
A: Tyrosine (Tyr) is an aromatic amino acid. It plays an important role in metabolism and the…
Q: What source was the information "As mentioned above these reactions occur in the metabolic pathway…
A: A patient's blood work suggests that: there is elevated AST/ALT ALT, which indicates excess nitrogen…
Q: protein is purified and at a concentration of 600 μg in 1.75 ml of buffer. You do an assay with your…
A: Protein purification is a fundamental process in biochemistry that involves isolating a specific…
Q: (4) Can this disaccharide be digested by human beings? What will happen if we don't digest it? How…
A: Carbohydrates are biomolecules that are made up of carbon, hydrogen, and oxygen. Carbohydrates can…
Q: 5.. A sample of cells has a total receptor concentration of 25 mM. Ninety percent of the receptors…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 4. Which of the following is a correct description of the peptide segment shown below? A. The amino…
A: Amino acids joined by peptide bonds form compounds known as peptides. These macromolecules, which…
Q: Describe the postprandial state. which occurs after meal ingestion. Talk about the biological…
A: The postprandial state, also known as the fed state, encompasses the period after meal ingestion…
Q: 6. At pH 7.0, the amino acid lysine has the structure shown here. Draw the structure of this…
A: Amino acids are biomolecules where an alpha-carbon is bonded to 4 different groups. The 4 groups…
Q: The following question focuses on how the parameters regulating enzyme function might change, and…
A: Michaelis-Menten (MM) plot and Lineweaver Burk (LB) plot are drawn to decipher the kinetic…
Q: Watch the following videos and answer the questions below. 1. Basic chemistry for Physiology…
A: In Biochemistry there are various terms used to describe things which have a very important meaning…
Q: Draw the structure of Arg - Lys - Ser - Trp at ph 7.4
A: The proteins are biological macromolecules that are composed of twenty naturally occurring amino…
Q: Chemical scheme for enzyme catalysis (a) Write the chemical equations for enzyme, substrate,…
A: Enzymes are biological catalysts that increase the rate of biochemical reactions.Most enzymes are…
Q: Carbohydrates: Draw the structures of the two products obtained when lactose is subjected to…
A: Lactose is a disaccharide composed of a and a . The C1 of forms a glycosidic bond with C4 of…
Q: Consider the following scenario: A group of five treasure hunters have been hired to retrieve some…
A: The objective of the first part of the question is to determine the optimal speed of travel for the…
Q: Dihybrid Cross Problem 7: Homozygous offspring of a dihybrid cross. In a dihybrid cross, AaBb x…
A: The objective of this question is to determine the fraction of offspring that will be homozygous for…
Q: How would you make THC-analogue that contains a C9 chain instead of the C5 chain? (answer only with…
A: In order to decipher how to make a THC analogue with a C9 chain, we need to know how a normal THC…
Q: Enalaprilat is a competitive inhibitor of the angiotensin-converting enzyme (ACE), which cleaves the…
A: Here, ACE is the enzyme, angiotensin I is the substrate and enalaprilat is the inhibitor.Given…
Q: An engineered ligand binds its target with 5 nM affinity at high pH. However, protonation of a…
A: An engineered ligand (L) binds to a target protein (T) to form a ligand:target complex (LT). The…
Q: Check the box under each molecule for which the statement in the first column is true. statement It…
A: The majority of biological processes require ribonucleic acid (RNA), a polymeric molecule that…
Q: Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with…
A: Correct Answer:Negative Enthalpy from Hydrogen Bonding between GC and AT Pairs:Explanation:The…
Q: if the absorbance of pure chlorophyll a in a 1 cm cell is 0.876 at 530 nm and the concentration is…
A:
Q: Which statement accurately describes structure A in the figure above? B. H A. Н c=0 H-C-OH НО-C-H…
A: D and L designations of sugars are given on the basis of position of the hydroxyl group on the…
Q: Draw a mechanism for the following reaction.
A: Both the reactions in question involve phosphate groups (in ATP and ADP) where a nucleophile attacks…
Q: how is sfGFP different than the wildtype GFP found in jellyfish
A: The question is asking about the differences between sfGFP (superfolder Green Fluorescent Protein)…
Q: If you discover that a protein binds more than one molecule (ligand). How can you determine whether…
A: Proteins are the large and complex biomolecules composed of a large number of amino acids attached…
Q: 1. (a) In class thus far, we have focused our membrane transport energetics discussions on the…
A: Cell membrane acts as a selective filter, allowing the free movement of some molecules across it…
Q: Which of the twenty naturally occurring amino acid side chains are charged at a pan of 1.00? pH of…
A: Amino acids can be defined as organic compounds which comprise of both amino & carboxylic acid…
Q: Why do you see a sharp decline in this graph at pHs higher and lower than 6? Effect of pH on Enzyme…
A: The graph shows how pH affects the activity of the enzymes. Enzyme activity is displayed on the…
Q: Genetics Question 9
A: The objective of the question is to determine whether the statement that cystic fibrosis can be…
Q: a) НО b) 1) Name each listed compound (a, b, c, d) below, 2) Arrange them in a right reaction order…
A: The given compounds are from the reaction of glucuronidation.Compound structural names as given…
Q: NAD in its reduced form is symbolized as Select one: O a. NAD. O b. NAD. O C. NADP+. O d. NADP.…
A: Reduced form of a substance or molecule is the form that has gained electrons or hydrogens in a…
Q: Enter the product of this Schiff base formation reaction: OH OH OPO3²- OH where R. represents…
A: Schiff bases are compunds with a double bond between a carbon and a nitrogen atom.
Q: Antibodies are one of the key elements in the human immune system. a. What is the general structure…
A: A big Y-shaped protein called an antibody (Ab), sometimes referred to as an immunoglobulin (Ig), is…
Q: Shown below, a student spotted the three-component mixture onto a TLC plate and developed it using…
A: TLC is the simple chromatography technique in which compounds are separated according to their…
Q: Which of the following replication mechanisms for circular DNA does not require DNA topoisomerase?…
A: Topoisomerases are the enzymes involving in DNA replication process. They help in relaxing the…
Q: Intramitochondrial ATP concentrations are about 5 mM, and phosphate concentration is about 10 mM.…
A: The energy charge of a living cell is a metric that indicates the energy status of the cell. The…
Q: A nonapeptide was determined to have the following amino acid composition: (Lys)2, (Gly) 2, (Phe) 2,…
A: Trypsin - Cleaves at Carboxyl terminus of basic amino acid such as lysine and arginine. Ahead of…
Q: D-ribose (Figure 1) is treated with a mild oxidizing agent. Edit the structure for D-ribose to show…
A: Oxidation of sugar is very important in the determination of carbohydrates. Reagents used for…
Q: Assessment 2: scenario based assessment Instructions This is a ‘scenario problem’. Read the…
A: The objective of the first question is to determine the optimal speed of travel for the treasure…
Q: 4- Salicylamides are inhibitors for an enzyme called scytalone dehydratase. SAR shows that there are…
A: Bioisosteres are molecules or functional groups that can be substituted for one another in drug…
Q: Dihybrid Cross Problem 2: When does a phenotype ratio of 9:3:3:1 occur? A phenotype ratio of 9:3:3:1…
A: The objective of the question is to identify the correct condition under which a phenotype ratio of…
Q: Choose False during an enzyme catalyzed reaction. Substrate concentration is typically much larger…
A: Enzyme kinetics is the field of biochemistry concerned with quantitative measurement of the rates of…
Q: A tripeptide on selective hydrolysis gives two fragments X and Y. The Fragment X consists of glycine…
A: Peptides are the long chains of amino acids joined by peptide bonds. Each amino acid has two…
Q: D-galactose (Figure 2) reacts with methanol. Edit the structure of D-galactose drawn below to create…
A: Carbohydrates such as monosaccharides reacts with methanol in the presence of an acid to form acetal…
Q: B A Which sketches represent the action of an enzyme? Check none of them if none of them do. B And…
A: There are three sketches 1, 2 and 3 with labelling A, B and C. We need to identify the enzyme action…
Q: Part A What kind of inhibition is imposed on HIV protease by ritonavir? O irreversible inhibition O…
A: Enzyme inhibition is when an inhibitor binds to the enzyme at the active site or another site, which…
Not too sure if my answer is correct.
Step by step
Solved in 3 steps
- QUESTION 4 What is the name for the complex that forms when many ribosomes translate the same MRNA at the same time? Polyribosome Polytranslational complex Spliceosome Transcription initiation complexQuestion / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG AAG The original template for this process is: O DNA O TRNA O FRNA O MRNAThis question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.
- Which of the following statement about mRNA is TRUE? Question 12 options: mRNA splicing is a conserved process in both prokaryotes and eukaryotes. Post-transcriptional regulation of gene expression may occur outside of the nucleus in eukaryotes. In eukaryotes, mRNA maturation requires 5'-capping, splicing and the addition of poly A tails. mRNA is transported out of the nucleus for translation in eukarytotes.To which of the following tRNA structures is the amino acid attached with during aminoacylation? Question 40 options: D arm 3' acceptor arm Variable arm Anti-codon loop TψC armBefore the next elongation cycle can take place at a ribosome, the peptide chain of the peptidyl-tRNA has to be transferred to the ___ site and the deacylated tRNA has to move to the ___site. Question 46 options: A, P P, A A, E P, E there is no peptidyl transfer happening during protein translation
- This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCG AGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from this MRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.True/False Question (suggested time - up to 1 minute): A particular (RNA can recognize only one specific codon in an mRNA. O True O False A Meving to another question will save this response.Question:- What is the role of tRNA? To replace T with U when transcribing mRNA. To bind the ribosome and the mRNA chain together. To transcribe the DNA and move the mRNA chain out of the nucleus. To assure that the mRNA chain carries the correct code. To carry the correct amino acids to the ribosome.
- How many tRNA molecules can associate with a ribosome at any given time during translationWhich of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' endQuestion 9 of 10 Question 9. If a mutation occurs such that there is a duplication of the A in the 3rd codon of the MRNA sequence below. This is called a mutation. 5' - AUG CUC UAC-3'