Font Paragraph Styles Editing Voice Editor Reuse Files ...1. .. 2. . . 3 -. . .. 4- . ... 5-... 6.. 7... . 8... . . . .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into MRNA. Then use the MRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. ТАССAGTTAGTтсGTAGACACCсТСAGTGGATCАССТСCGGGATАТАААССАААСGсCСCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA CTCTCCCAAGAAAATGATGGGGTTTCGTCCATAACACCTTGTCACAACAGCAAGACAAAC GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCTTААТААСGATCTАА UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
How is transcription and translation simulated in this activity?


Trending now
This is a popular solution!
Step by step
Solved in 2 steps









