How is transcription and translation simulated in this activity? AutoSave ● ffBUILD A PROTEIN LAB ACTIVITY • Saved to this PC -O Search (Alt+Q)A Tanya Abigail ClemenTAFileHomeInsertDrawDesignLayoutReferencesMailingsReviewViewHelpO Comments vA ShareX Cut- A A Aa v A aba AO Find vTimes New Romar v 12LE CopyS ReplacePasteDictateEditorReuseB IU v ab x, x A vevA Select vS Format PainterFilesClipboardFontParagraphStylesEditingVoiceEditorReuse FilesL1 ... .145. . .| . . . 68.I ..As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below,you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood.Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein.Use the three letter abbreviations contained in the table to fill in the beef insulin molecule.TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCTAUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGAСтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAСGAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUGАAGCAACATGGTTAACCTCТTААТААСGAТСТААТТUUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA"BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value).O Focus100%3:09 PMO Type here to search日w25°C Rain3/8/2022

Name: How is transcription and translation simulated in this activity? AutoS
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: How is transcription and translation simulated in this activity? AutoSave ● ffBUILD A PROTEIN LAB ACTIVITY • Saved to this PC -O Search (Alt+Q)A Tanya Abigail ClemenTAFileHomeInsertDrawDesignLayoutReferencesMailingsReviewViewHelpO Comments vA ShareX