Lesson 2 Focus Questions 1. What chemicals and molecules are needed for PCR, and what is the function of each component? 2. Examine the 150 base promoter sequence below. 5'TAGAAAAGGA AGG CTACAAAT CATCATTGCGA TAAAGGAAAG GTATCATTC AAGATGCCTC TGCCGACAGT GGTCCCAAAG ATGGACCCCC ACCCACGAGG AGC ATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCTTCAA3¹ Write in the sequence of the complementary strand and mark the 3' and 5' ends of the complementary strand. :

Q: A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a mutation…

A: Nonsense codon The mRNA sequences; UAA, UAG, UGA signals the termination of the process of…

Q: 4 of e flag Transcribe the following DNA: TACGGGGCTGAGATT Select one: a. UACGGGGCUGAGAUU O b.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize RNA…

Q: In moelcular genetics, initiation is often accomplished using proteins that prevent elongation.…

A: Initiation of a process in genetics is an important event. At this stage, cell prepare itself for…

Q: 1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly discovered species…

A: Since you have asked multiple question, and need help in 1 & 2, we will solve the first and…

Q: estion Completion Status: You are studying a group of individuals with X-ray vision and perform…

A: Restriction endonucleases These are restriction enzymes that have been isolated from the bacteria.…

Q: Directions: Write the letter of the correct answer on a separate sheet of paper. 1. Which type of…

A: 1. In this question Nucleic acids are correct as deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: A. What organelle is responsible for Translation?

A: Protein synthesis is the process of creating protein molecules. It involves amino acid synthesis,…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…

A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Q: expression. List two types of mutations that can explain this phenotype. Justify each of the…

A: Mutation means altering the nucleotide sequence of the genome in a living organism or virus or DNA.…

Q: Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a.…

A: Coding sequence codes for functional protein products. Coding sequence codes for the functional…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION  It is the process in which the genetic information present on one…

Q: 5.Below is schematic of gene Z, which encodes for protein Z. the promoter is indicated by the dotted…

A: Given information In the diagram , there are Exon 1, Exon 2 and Exon 3. There are two introns 1 and…

Q: Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or…

A: Dilution Factor (DF) can be expressed as ratio of volumes and as ratio of concentrations. DF…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: 1. The enzyme V is responsible for unzipping the helix to start the process of replication. 2. is…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. DNA used as…

Q: WORKSHEET TASK 3: 1.     Below is a theoretical section of DNA. Design two primers that are 10 base…

A: In the mid-1980s, an important revolu- tionary technique of molecular biology PCR or Polymerase…

Q: a.) Which of the following molecules would you need to mutate a gene with non-homologous chromosomal…

A: Gene expression is defined as the process by which genetic data encoded inside a gene is used to…

Q: 1. Why is a poly-A tail important? 2. What do introns do? Why do they exist in eukaryotes when they…

A: Transcription is the second important stage of central dogma involving the formation of an mRNA…

Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…

A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…

Q: mutagenesis using degenerate

A: 5. Random mutagenesis can also be accomplished by the insertion or deletion of nucleotides from a…

Q: Which of the following sequences template ONA would likely code for a narpin transcription terminat…

A: The sequence provided is likely a template DNA sequence. Transcription termination signals are…

Q: Next, it's important to understand how the gene would be transcribed and translated. 1 agagtctcct…

A: i. Coding region of this gene is 288 nucleotide long.  ii. We all know that exons are the coding…

Q: When pieces of DNA that were not originally from a bacterial cell get integrated into its…

A: Introduction :- Bacteria are prokaryotic organisms . They do not have a well defined nucleus and…

Q: Q4.6. What does it mean to say that extension by DNA polymerase IIl proceeds 5'-3'? The 5' end of a…

A: The DNA polymerase-lll is the main replicating enzyme that synthesize new DNA from the old DNA. The…

Q: Questions:- 6. In prokaryotes, which DNA polymerase is primarily responsible for filling in the…

A: NER (nucleotide excision repair) is a critical DNA (deoxyribonucleic acid) repair mechanism. It is…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: Kari and Jamal are studying a genetic trait that is controlled by two genes, Gene 1 and Gene 2. Kari…

A: In molecular biology there is a theory called central dogma of life. This theory states that the…

Q: nucleotide is in the left column, and second codon nucleotide is on top. The m allele sequences are…

A: Sense strand of the coding strand is the segment of DNA that carries the code that can be…

Q: Mission 3.3.3. Connect the description with the correct term. ____1___ Mutation 2 Shiny and dull 4…

A: DNA or deoxyribonucleic acid is the genetic material of living organisms. It is a double stranded…

Q: 9. A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Nucleotides are  the building blocks of nucleic acids that are DNA and RNA. It is made up of sugar…

Q: Question Completion Status: You are studying a group of individuals with X-ray vision and perform…

A: Colonies having X ray genes :-

Q: 5. You are given three different substances that are known mutagens. Using a variety of techniques,…

A: Mutagens are specific compounds that are responsible for increasing the frequency of mutations.…

Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers 6. What are…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: Match the mutation with the appropriate term. Answers may be u all Results in protein that cannot be…

A: Philadelphia chromosome is a gentica abnornamlity which is due to the translocation between the…

Q: Task #3: Design primers 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61…

A: A primer is a short single-stranded nucleotide chain used for the initiation of DNA synthesis. In…

Q: Design Layout References Mailings Review View ACROBAT 12.5 A A Aa-EEEE alibri - IU-abe X₂ x² A-ay-…

A: Introduction: Messenger RNA (mRNA) is a molecule that plays an important function in gene…

Q: Guide Questlons: How do the nucleotides in DNA pair? How do you compare a DNA molecule to a zipper?…

A: According to the question, we have to give a solution on the nucleotides in the DNA pair and in…

Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…

A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…

Q: 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence…

A: A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'

Q: True or False

A: Since you have asked a question with multiple subparts, according to our policy, we are eligible to…

Q: 7. A segment of DNA from Hippopotamus amphibius has the sequence below. Assuming that this is the…

A: The mRNA produced by the process of transcription. RNA polymerase enzyme utilised in the process of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.