Hi, I need help filling in the table. Activity 2: Set up ligation reaction for Hpall and Mspl-digested samples.You will ligate the sequencing adaptor to the gDNA samples digested with either Mspl or Hpall. Theligated samples will then be amplified using the 20-mer primer.A.5' CGACGTCGACTATCCATGAACAGC 3'3' GTACTTGTCGGC 5'B.5' CCGG 3'3' GGCC 5'5' C3' GGCFigure. 8 Details of the Sequencing Adaptor. A. This double stranded adaptor was prepared byannealing the AdaptorSEQ_FWD and AdaptorSEQ_REV primers. Note the 2bp GC overhang thatis complementary to the GC overhang generated by digestion of the sequence CCGG with Hpall orMspl (right, B)Mspl or Hpall-digested gDNASequencing Adaptor (5μM)Procedure:1. Select 0.2ml (200μl) tubes for the ligation reaction2. Identify the tube with the double-stranded adaptor that is provided at a concentration of 5μM.The ligation is done in a final total volume of 20μl. Calculate the volume that must be addedto the ligation reaction such that the double-stranded adaptor is present at either 0.5 or 1 μMin the final reaction3. The ligation is done with 200ng of Hpall or Mspl-digested DNA. Calculate the volume ofdigested gDNA required for the ligation reaction, and add this to the double-stranded adaptor4. Add the appropriate amount of water to the double-stranded adaptor and Hpall or Mspl-digested DNA as per Table 4Table 4. Ligation of Sequencing adaptor to digested genomic DNAComponentsAmount5. Anneal the double-stranded adaptor and Hpall or Mspl-digested DNA by using a PCRthermocycler to heat the sample to 55°C and then cool it to 22°C over 1 hour6. Add 1μl of DNA ligase and incubate for 60 minutes at 22°C13250ngYou will add adaptor to a finalconcentration of either 0.5 or 1μM -please ask the laboratory supervisor1 X in final reactionVolume (to 20μl)2X Quick ligation bufferWater to a final volume of 19μlBefore adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hourQuick Ligase1μl1μl

Dilution Factor (DF) can be expressed as ratio of volumes and as ratio of concentrations. DF…

Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or Hpall-digested gDNA Sequencing Adaptor (5μM) 250ng You will add adaptor to a final concentration of either 0.5 or 1μM - please ask the laboratory supervisor 1 X in final reaction Volume (to 20μl) 2X Quick ligation buffer Water to a final volume of 19μl Before adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hour Quick Ligase 1μl ابرا

Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or Hpall-digested gDNA Sequencing Adaptor (5μM) 250ng You will add adaptor to a final concentration of either 0.5 or 1μM - please ask the laboratory supervisor 1 X in final reaction Volume (to 20μl) 2X Quick ligation buffer Water to a final volume of 19μl Before adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hour Quick Ligase 1μl ابرا

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

help me, please?
Can Alex be Frank’s father? Why or why not?
I need help figuring out the two, i wrote down everything that happens & I don’t see anything about those two
Can you be more specific please?
Wy do i want to be a teacher