QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the gene is show below: 3' 5' ATGAATACAAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTTTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' The modified sequence is shown below, with the mutation highlighted in bold: 3' 5' 3' 3' ATGAATACATAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTATTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' Q2: What effect will this mutation have on Gal1 expression? There will be no effect O Gal1 will always be ON O Gal1 will always be OFF O Gal1 will be expressed only when galactose is present in the cell O Gal1 will be expressed only when galactose is absent from the cell QUESTION 10

Q: Can you help me the name of the brain with the blood of the labels?

A: The mass of nerve tissue in the anterior edge of an organism is the Brain. The brain integrates…

Q: Give the IUPAC name of each compound. Part 1 of 4 Part 2 of 4 ☑ ☑

A: There are some rule to write name of cyclo alkane,1-Numbering the carbon present in the cyclic…

Q: 24kg= Ibs

A: A kilogram (kg) is said to be 2.2 times heavier than a pound (represented as lbs).Thus, one kilo of…

Q: Body symmetry: Drawing of organism: #5 Distinctive features: Domain: but ri to consider that all…

A: Sponges are multicellular organisms that are studied under spongiology. They are heterotrophic…

Q: Medications for diabetes

A: Diabetes Mellitus: Diabetes is a chronic medical condition characterized by high levels of glucose…

Q: 2. Type of hormone 3. Hormone structure 4. Gland that secretes the hormone

A: Hormones are the chemical substances released/secreted by specialized cells into the extracellular…

Q: What is atheroma?

A: It is a disease of arteries.

Q: 22 m Taranto, Italy °C mm 17.2°C 538 mm 300 in climate: ight... 40- and a moi 80 30 - 60 20- 40 10-…

A: Evapotranspiration is basically a process by which water is transferred from the land area to the…

Q: 皮

A: Skeletal system is a body system which form structural framework around the body and helps in…

Q: What is a usuai Y-incision?

A: Incisions are defined as the surgical cuts that are carefully made on the body of the person in…

Q: III IV VI VII

A: The kidneys are bean-shaped organs that filter blood. It is made up of millions of nephrons which…

Q: differences between AKI vs CRK

A: Kidneys are the major excretory organs located in the retroperitoneal space. One kidney is located…

Q: Observe the structures above and answer the questions below. Please pay attention to the number of…

A: All these structures given are protein domain or motif structure and is part of many large protein…

Q: Identify #4 3 1 2

A: The diagram represents the larynx. The larynx is a muscular tube found just below the pharynx. The…

Q: 10 is missing

A: DNA or deoxyribonucleic acid is the genetic material in living organisms which is made up of…

Q: Definition miosis

A: Vision is possible only when the light reflected from an object falls on the retina of the eye. The…

Q: diathroses

A: The study of joint is termed as arthrology. A joint or articulation is a point of contact between…

Q: how do you know if the duiretic was effective

A: Diuretics are drugs that prevent the reabsorption of water from kidney tubules and thereby increase…

Q: 12 15 13 14 16 17

A: Sperms are the male reproductive cells that carry hereditary information from father to child. It is…

Q: What heart chamber is at the arrow?

A: The body needs oxygen for proper functioning and the heart is the organ that transports oxygen all…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.