Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- -3' -3' c. Trp-Phe-Asn-Gln
Q: Can your draw it out and explain it to me please
A: Dilution : The process of lowering a solute's concentration in a solution by increasing the solvent,…
Q: Table 2 This table is for gathering data on the effects of temperature, light, or seed type on…
A: The objective of this question is to create a graph that compares the rate of respiration of…
Q: researcher studying two species (species 1 and species 2) sequences a short stretch of eight codons…
A: Genes are the hereditary structures on DNA responsible for encoding a particular function/ trait.…
Q: Why is the Nipah virus a great illustration of a zoonotic disease? A. Because it's carried…
A: The objective of the question is to understand why the Nipah virus is a good example of a zoonotic…
Q: Using correct anatomical terminology, please write like you are talking and teaching a pre…
A: Nowadays we’re going to learn about a very critical portion of our bodies called the reproductive…
Q: Which of these is not true about the physiologic effects of estrogen? Group of answer choices…
A: The development and upkeep of female reproductive tissues are principally linked to the steroid…
Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…
A: Transcription and translation are key forms in molecular science that convert the hereditary data in…
Q: Which of the following factors indicates the largest risk for breast cancer? Having a mother or…
A: The objective of the question is to identify the factor that poses the greatest risk for developing…
Q: In sickle cell anemia, the defective hemoglobin differs from the normal hemoglobin by O the total…
A: The inquiry aims to identify the specific difference between defective hemoglobin in sickle cell…
Q: A 5.) a. Choose the figure (A or B) where nondisjunction occurs in Meiosis I. b. Explain…
A: Nondisjunction is an error in cell division that happens when homologous chromosomes or sister…
Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…
A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…
Q: What are some constraints shared by all organisms? (select all those that apply). a) withstanding…
A: Any biological living system that performs the role of a distinct living form is called an organism.…
Q: How would I calculate sanger sequencing fragments that will produce green
A: Sanger sequencing is a method used to determine the sequence of DNA by incorporating…
Q: Describe what it might be like to have presbycusis. How would your ability to converse with others…
A: Presbycusis is age age-related hearing loss is the gradual loss of hearing in both ears. It is…
Q: Question 1: Individuals with sickle cell trait (AS heterozygotes) are more resistant to malaria than…
A: The interaction between genetics and the environment shapes the evolution of populations.…
Q: You are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400…
A: The whole collection of DNA instructions present in a cell is called the genome. The genome of a…
Q: Epithelial tissue is an important part of the body as a covering of surfaces and as a lining of the…
A: Epithelial tissue serves as a basic obstruction and interface between the body and the outside…
Q: Which of the following components of the mitochondrial electron transport chain is the only one to…
A: The mitochondrial electron transport chain is a series of protein complexes and electron carrier…
Q: In the determination of ethanol concentration in alcoholic beverages using the GCFID method, why do…
A: The objective of the question is to understand the importance of calculating the coefficient of…
Q: Researchers have discovered that androgens and estrogens have ..... effects on the brain,…
A: The question is asking about the type of effects that androgens and estrogens, which are types of…
Q: Did your mutation actually disrupt binding? Please choose the best explanation based on what you…
A: Protein binding affinity elucidates the intensity of interactions between proteins and their…
Q: Immune system of humans a) Secreted B cell receptors can function as opsonins. b) MHC class II…
A: The immune system is a complex network of cells, tissues, and organs that work together to defend…
Q: Which of the following is NOT given as an advantage of using CRISPR-Cas in diagnosing infections in…
A: The correct answer is option D. It will protect the patient's kidney from invading DNA.
Q: Photosynthetic organisms produce a lot of NPP on earth. Which of the below statements is true? OA.…
A: Net Primar Productivity is the rate at which autotrophs convert light energy to chemical energy. It…
Q: Q1: Describe how the sympathetic and parasympathetic nervous system affects the following organs:…
A: In human body sympathetic and parasympathetic nervous systems work in opposite manner or…
Q: What is the difference in the H* concentration between lemon juice (pH 2) and black coffee (pH 5)? O…
A: pH, or the potential of hydrogen, is a measure of the acidity or alkalinity of a solution. It…
Q: What is the significance of considering and incorporating health or healthcare disparities in…
A: The objective of the question is to understand the importance of considering health disparities in…
Q: A microbiologist inoculated a flask of nutrient broth with E. coli. The bacterial population entered…
A: In the realm of microbiology, understanding the dynamics of bacterial population growth is crucial…
Q: Why is smallpox so dangerous? A. It has killed more people in human history than any other…
A: The question is asking why smallpox is considered a dangerous disease. Smallpox is a highly…
Q: There are two genetically-determined traits that are seen in a species of salamander. The S-gene…
A: A dihybrid cross is a breeding experiment between P-generation (parental generation) organisms that…
Q: 40) The molecular forces that hold the proteins of a capsule together are covalent bonds. True or…
A: The topics covered include chromosomal dynamics in the cell cycle, the historical background of gene…
Q: Approximately what percentage of food is wasted? Question 2Select one: a. 20% b. 33% c. 75%…
A: The question is asking for an approximate percentage of food that is wasted globally. This is a…
Q: 8. Describe the differences between ionotropic and metabotropic signaling in the brain with respect…
A: Signaling is the process by which cells communicate with each other.
Q: Select the correct mode of inheritance corresponding to this information: Females with AA or Aa…
A: Basic introduction about disease heredityAutosomal disease In this case, autosomes (except X & Y…
Q: How is the Zika virus spread? A. Through person-to-person contact B. Through…
A: The objective of the question is to understand the mode of transmission of the Zika virus.
Q: Which of the following statements is NOT true about the sensory systems? Chemoreceptors are…
A: The sensory system is a part of the nervous system responsible for processing sensory information. A…
Q: Are any continents predicted to have a negative growth rate in the next century? OA. Yes, all…
A: Population growth is a complex and dynamic phenomenon influenced by various factors such as…
Q: Part 1:Then write a two to four page position paper: Is the Three Gorges Dam doing more good than…
A: The Three Gorges Dam, one of the biggest hydroelectric ventures globally, has been a subject of…
Q: Answer the following two questions about DNA replication. On a DNA strand that is being synthesized,…
A: A crucial step in the cell cycle, DNA replication guarantees the accurate transfer of genetic…
Q: oteins, assembled in a stepwise r Once the core octamer has been formed, DNA wraps around it to form…
A: Nucleosome is a super coiled model of DNA which is arranged as bead and string model with the beads…
Q: New York was one of the largest slave-holding states in the U.S. and it was one of the last northern…
A: The question is asking whether New York was one of the largest slave-holding states in the U.S. and…
Q: To stop the chain of infection, Nigerian health officials launched an army of contact tracers and…
A: Contact tracing is a by identifying the individual who are contact with the person with a…
Q: A cytosine is deaminated, forming uracil. Which DNA repair systems is best able to correct this…
A: The objective of the question is to identify the DNA repair system that is best suited to correct…
Q: Describe an example of a positive feedback loop in the context of climate change.
A: The long-term modification of Earth's temperature, mostly brought about by human activities…
Q: he main benefit of a three-dimensional culture system is that: O the morphology and behavior of…
A: In the realm of biological sciences, three-dimensional (3D) cell culture systems represent…
Q: What is coral and why it it important to preserve
A: Corals refer to the structures of settlements of little, delicate-bodied marine organic entities…
Q: Which of the following compounds has (have) vitamin C activity? Select all that apply. Group of…
A: Vitamin C is a water soluble vitamin. It is also called as ascorbic acid. It is an essential…
Q: Short answer question: Describe one function of forest ecosystems.
A: By collecting carbon dioxide during photosynthesis, the process by which trees turn sunlight into…
Q: 1) How many promoters control the expression of these genes? 2) How many locations does RNA…
A: An operon is a unit of genetic regulation found in prokaryotic organisms like bacteria and archaea.…
Q: Why did Ebola spread so easily across the world in 2014? A. Because laboratories were easily…
A: The question is asking for the reason why the Ebola virus was able to spread so easily across the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainAll about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the pre-mRNA B. lariat formation is necessary to bring the branch site with the 5' splice site of the intron C. an unstable 5'P and 2'OH phosphodiester bond helps form the lariat D. exon 5' splice site consensus sequence GU and its 3' splice site AG are recognized by snRNPs E. various types of snRNPs and the pre-RNA come together to form the spliceosome A, B, C, E only A, B, C, D, E A, B, C only B, C, D, E onlyPlease help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationale
- Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic bond connect the phosphate group to ribose. Before the mRNA can be used in translation, it has to undergo splicing, 3’ cap and 5' poly-A tail post-transcription modifications.
- tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNATranslation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) TerminusAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.
- Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a really small gene and matching complete amino acid sequence of its gene product. GGT ATG GGG ACT TTG AGG ATG ATA AGG CGT AAA TAA ATAT Met Gly Thr Leu Arg Met Ile Arg Arg Lys A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the likely mutation? between T14 and G15, insert T. G7 -> del. T5 -> del. G29, T30, A31 -> del between T14 and G15, insert AA. A31 -> T. C11 -> delFigure out the mutation. You will need the codon table to answer this question. Wild type DNA sequence at 5' end of the coding region and the corresponding wild type protein sequence of its amino end: ACA TAA ATG TCT CAG TAT GGG TAT GAG AAC GAC ATT CAC ATA ATT ... Met Ser Gln Tyr Gly Tyr Glu Asn Asp Ile His Ile Ile ... This protein sequence matches the DNA sequence exactly in the wild type. A mutant is found that has the following protein sequence: Met Ser Gln Tyr Gly Thr Phe Thr. What is the likely mutation? between T4 and A5, insert G between C13 and A14, insert C G9 -> del between G20 and G31 -> del T24 -> A T22 -> GChrome ... x ← C Port A m ERNA F i t DESE a e d Use the codon table to determine which mRNA triplets code for the amino acid cysteine, Cys. Second mRNA base C A (5' 0 f COTON COCO с b CUA OG Course H U 000 UUU UUC UUA UUG CUU CUC CUG AUU AUA AUG Submit GUU mylabmastering.pearson.com/?courseid=12411621&key=28... ☆ GUC AUC lle UGG UGC UGU ACA AGU U 833 Phe Leu GUA n) GUG Select all that apply. Leu View Met or start Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG 160 History Bookmarks Profiles Tab Window Help QuickLaun X Thr Request Answer Ser Pro Ala UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu CGA UGU UGC UGA Stop A UGG Trp G CGU U CGC CGG AGU AGC AGA AGG GGU GGC GGA QuickLaury X G GGG Cys Arg Ser Arg Gly NOV 6 UT h CA A b a G U C G So OcO O COTON Right to be (3¹ X Gn) M (no subje x ☆出口口 **** 31 + U JO